Incidental Mutation 'R8809:Zfp62'
ID672291
Institutional Source Beutler Lab
Gene Symbol Zfp62
Ensembl Gene ENSMUSG00000046311
Gene Namezinc finger protein 62
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R8809 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49203292-49218816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49216411 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 443 (N443S)
Ref Sequence ENSEMBL: ENSMUSP00000056226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061757] [ENSMUST00000109197] [ENSMUST00000109198] [ENSMUST00000133150] [ENSMUST00000136539] [ENSMUST00000136691] [ENSMUST00000137061] [ENSMUST00000150284] [ENSMUST00000151228] [ENSMUST00000180016]
Predicted Effect probably damaging
Transcript: ENSMUST00000061757
AA Change: N443S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056226
Gene: ENSMUSG00000046311
AA Change: N443S

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109197
AA Change: N443S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104820
Gene: ENSMUSG00000046311
AA Change: N443S

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109198
AA Change: N443S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104821
Gene: ENSMUSG00000046311
AA Change: N443S

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133150
Predicted Effect probably damaging
Transcript: ENSMUST00000136539
AA Change: N443S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116045
Gene: ENSMUSG00000046311
AA Change: N443S

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136691
Predicted Effect probably benign
Transcript: ENSMUST00000137061
Predicted Effect probably benign
Transcript: ENSMUST00000150284
Predicted Effect probably benign
Transcript: ENSMUST00000151228
SMART Domains Protein: ENSMUSP00000117774
Gene: ENSMUSG00000046311

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
Pfam:zf-C2H2_6 179 195 2.3e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180016
AA Change: N443S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137583
Gene: ENSMUSG00000046311
AA Change: N443S

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr6 C T 10: 89,714,979 V318I probably benign Het
Adam29 A G 8: 55,872,624 I265T probably benign Het
AI464131 T C 4: 41,498,812 T273A probably benign Het
Arcn1 T C 9: 44,743,962 T501A possibly damaging Het
B3gntl1 A T 11: 121,630,864 F166I possibly damaging Het
Brap T C 5: 121,684,461 S467P possibly damaging Het
Cenpb A G 2: 131,178,402 V492A unknown Het
Ces1b C A 8: 93,060,320 G477V probably damaging Het
Ces1b C T 8: 93,060,321 G477R probably damaging Het
Cfap65 T C 1: 74,903,223 K1724R probably benign Het
Chrd A T 16: 20,734,520 Q182L probably benign Het
Chrnb2 T C 3: 89,757,150 T486A probably benign Het
Col25a1 A T 3: 130,560,817 probably null Het
Col4a1 A G 8: 11,245,916 Y101H unknown Het
Crybg1 T C 10: 44,003,432 T587A probably damaging Het
Ctnnal1 T A 4: 56,835,374 N301I possibly damaging Het
Cyp2f2 A T 7: 27,132,570 N417Y probably damaging Het
Dnah6 T A 6: 73,032,563 E3800D possibly damaging Het
Ehmt2 C A 17: 34,908,513 T906K probably damaging Het
Fbxo15 A G 18: 84,960,075 H183R possibly damaging Het
Fgl1 T A 8: 41,197,331 K194* probably null Het
Fxr1 G A 3: 34,054,281 V314I possibly damaging Het
Hrnr A G 3: 93,332,136 Q3227R unknown Het
Ier5 G A 1: 155,098,970 A154V probably benign Het
Igkc T G 6: 70,726,518 L28V Het
Kcnh1 G A 1: 192,221,414 G54D probably damaging Het
Kcnn1 C T 8: 70,852,653 probably null Het
Kif1bp C T 10: 62,559,712 D384N possibly damaging Het
Klra2 T A 6: 131,220,235 N234I possibly damaging Het
Krtap4-9 T C 11: 99,785,628 I125T unknown Het
Lrig2 T C 3: 104,461,677 T897A probably benign Het
Lyve1 G T 7: 110,853,792 T199K probably damaging Het
Napa A G 7: 16,112,626 D113G possibly damaging Het
Neurog1 GGTG GGTGTG 13: 56,251,285 probably null Het
Nf1 T A 11: 79,547,138 H91Q probably damaging Het
Olfr1205 T C 2: 88,831,912 M265T probably benign Het
Olfr180 T A 16: 58,915,885 Y252F probably damaging Het
Olfr594 A T 7: 103,220,239 N174Y probably benign Het
Olfr732 A G 14: 50,281,779 I158T probably benign Het
Olfr828 A G 9: 18,815,623 S224P probably damaging Het
Pccb A T 9: 100,985,167 Y455* probably null Het
Pdk2 A T 11: 95,032,513 I95N probably damaging Het
Pik3c2g G A 6: 139,768,710 R196H Het
Pkd1l2 A G 8: 116,999,921 L2282P probably damaging Het
Plppr2 TCGCC TC 9: 21,944,431 probably benign Het
Prdm1 A T 10: 44,439,753 S796T probably benign Het
Rb1 A G 14: 73,265,560 F424L probably damaging Het
Retreg3 A G 11: 101,102,026 L190P probably damaging Het
Rffl A G 11: 82,810,038 Y321H probably damaging Het
Rlbp1 A G 7: 79,375,956 Y246H probably damaging Het
Rock2 T A 12: 16,965,654 probably benign Het
Slc17a3 C A 13: 23,855,592 C244* probably null Het
Snapc1 T C 12: 73,975,038 S304P probably benign Het
Sp9 T C 2: 73,273,675 L191P probably damaging Het
Spag17 A T 3: 99,982,422 E202D probably benign Het
Ss18 A G 18: 14,627,287 *419R probably null Het
Tacc2 A G 7: 130,674,691 E1824G possibly damaging Het
Tfap2a A T 13: 40,717,353 L353Q probably damaging Het
Ugt3a2 A G 15: 9,367,259 I363V possibly damaging Het
Vmn1r158 A G 7: 22,790,350 C145R probably damaging Het
Vmn1r23 A T 6: 57,926,367 I142K probably damaging Het
Vmn2r15 A T 5: 109,287,008 I610N probably benign Het
Wdr60 A G 12: 116,229,614 S573P probably damaging Het
Yy1 CGGCGACCACGGCGGCGGCGGGGGCG CGGCG 12: 108,793,580 probably benign Het
Zbtb7c T C 18: 76,137,119 Y93H probably damaging Het
Other mutations in Zfp62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03342:Zfp62 APN 11 49215471 nonsense probably null
R0416:Zfp62 UTSW 11 49215676 missense probably damaging 1.00
R0540:Zfp62 UTSW 11 49215400 missense probably benign
R0607:Zfp62 UTSW 11 49215400 missense probably benign
R1119:Zfp62 UTSW 11 49216690 missense probably damaging 0.99
R1230:Zfp62 UTSW 11 49215099 missense probably damaging 0.96
R1644:Zfp62 UTSW 11 49215769 missense probably damaging 0.99
R1710:Zfp62 UTSW 11 49217683 missense probably benign
R1840:Zfp62 UTSW 11 49216388 missense probably damaging 1.00
R1908:Zfp62 UTSW 11 49216220 missense probably damaging 0.99
R3878:Zfp62 UTSW 11 49215133 missense probably damaging 0.99
R4571:Zfp62 UTSW 11 49215741 missense probably damaging 1.00
R4571:Zfp62 UTSW 11 49215742 missense probably damaging 1.00
R4580:Zfp62 UTSW 11 49216272 missense possibly damaging 0.91
R4631:Zfp62 UTSW 11 49217805 makesense probably null
R5022:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5023:Zfp62 UTSW 11 49215729 missense probably damaging 0.96
R5289:Zfp62 UTSW 11 49217148 missense probably damaging 0.98
R5362:Zfp62 UTSW 11 49216612 missense probably damaging 1.00
R5685:Zfp62 UTSW 11 49216217 nonsense probably null
R6420:Zfp62 UTSW 11 49216513 missense probably damaging 1.00
R6764:Zfp62 UTSW 11 49215169 missense probably damaging 0.99
R7000:Zfp62 UTSW 11 49216379 nonsense probably null
R7016:Zfp62 UTSW 11 49215937 missense probably damaging 0.98
R7175:Zfp62 UTSW 11 49216753 missense probably damaging 0.99
R7670:Zfp62 UTSW 11 49215076 start gained probably benign
R7675:Zfp62 UTSW 11 49216020 missense possibly damaging 0.75
R7686:Zfp62 UTSW 11 49217158 missense probably damaging 1.00
R7801:Zfp62 UTSW 11 49217328 missense possibly damaging 0.88
R8190:Zfp62 UTSW 11 49216075 missense probably damaging 1.00
R8390:Zfp62 UTSW 11 49215192 missense probably benign 0.02
R8401:Zfp62 UTSW 11 49217391 missense probably damaging 1.00
R8479:Zfp62 UTSW 11 49216492 missense probably damaging 0.98
R8735:Zfp62 UTSW 11 49217400 missense probably damaging 1.00
X0011:Zfp62 UTSW 11 49215598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATAGTTCAGGCCTTGCA -3'
(R):5'- AGTGTTCTGTATGTGATGAAGGC -3'

Sequencing Primer
(F):5'- GTTCAGGCCTTGCAGTCCATAAAAG -3'
(R):5'- GTGATGAAGGCTTTCTCACAC -3'
Posted On2021-04-30