Incidental Mutation 'K3955:Recql'
ID67230
Institutional Source Beutler Lab
Gene Symbol Recql
Ensembl Gene ENSMUSG00000030243
Gene NameRecQ protein-like
SynonymsRecQ1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #K3955 (G3) of strain 706
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142350342-142387087 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 142378206 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 54 (S54*)
Ref Sequence ENSEMBL: ENSMUSP00000145179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000100832] [ENSMUST00000111803] [ENSMUST00000128082] [ENSMUST00000129694] [ENSMUST00000203772]
Predicted Effect probably null
Transcript: ENSMUST00000032370
AA Change: S54*
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243
AA Change: S54*

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100832
AA Change: S54*
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243
AA Change: S54*

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111803
AA Change: S54*
SMART Domains Protein: ENSMUSP00000107434
Gene: ENSMUSG00000030243
AA Change: S54*

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RecQ_Zn_bind 420 479 2.5e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128082
AA Change: S54*
SMART Domains Protein: ENSMUSP00000120951
Gene: ENSMUSG00000030243
AA Change: S54*

DomainStartEndE-ValueType
Blast:DEXDc 24 84 4e-16 BLAST
PDB:2WWY|B 63 85 9e-9 PDB
Predicted Effect probably null
Transcript: ENSMUST00000129694
AA Change: S54*
SMART Domains Protein: ENSMUSP00000122328
Gene: ENSMUSG00000030243
AA Change: S54*

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
Pfam:DEAD 93 166 6.6e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203772
AA Change: S54*
SMART Domains Protein: ENSMUSP00000145179
Gene: ENSMUSG00000030243
AA Change: S54*

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
Pfam:DEAD 93 166 8.5e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RecQ DNA helicase family. DNA helicases are enzymes involved in various types of DNA repair, including mismatch repair, nucleotide excision repair and direct repair. The encoded protein is involved in the processing of Holliday junctions, the suppression of sister chromatid exchanges, telomere maintenance, and is required for genotoxic stress resistance. Defects in this gene have been associated with several types of cancer. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutation of this gene results in chromosomal instability, with embryonic fibroblasts exhibiting aneuploidy, spontaneous chromosomal breakage, frequent translocation events, increased sensitivity to ionizing radiation, and increased frequency of sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 G A 1: 89,887,604 R738H probably damaging Het
Arhgap28 T C 17: 68,004,006 E2G probably damaging Het
Atad2b C A 12: 4,954,536 probably benign Het
Atmin T A 8: 116,957,036 C478* probably null Het
Calr T C 8: 84,846,273 Y57C probably damaging Het
Cdh13 G A 8: 118,675,104 V82M probably damaging Het
Ces3a A T 8: 105,050,627 probably benign Het
Dmbt1 T C 7: 131,119,564 Y1854H probably damaging Het
Dnah1 T A 14: 31,266,459 M3429L probably benign Het
Dscam A G 16: 96,673,687 F1225S probably benign Het
E030025P04Rik G A 11: 109,143,952 P37S unknown Het
Eral1 A T 11: 78,076,021 D189E probably damaging Het
Fbxw14 G T 9: 109,276,245 P284Q possibly damaging Het
Fcrl6 A G 1: 172,597,684 V260A probably benign Het
Fezf2 A T 14: 12,345,097 F30Y probably damaging Het
Gjb4 A T 4: 127,351,500 V216D probably benign Het
Gm13023 T C 4: 143,795,140 I442T possibly damaging Het
Gm9758 G A 5: 14,913,508 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gmps A C 3: 64,001,533 R485S probably damaging Het
Gtdc1 C T 2: 44,752,221 probably null Het
H2-Ob C T 17: 34,241,184 R19C probably damaging Het
Lars2 T C 9: 123,377,777 V103A probably damaging Het
Ndnf G A 6: 65,701,429 probably benign Het
Nectin1 A G 9: 43,792,078 Y211C probably damaging Het
Notch4 C T 17: 34,568,462 T332I probably damaging Het
Olfr272 A G 4: 52,911,081 F238L probably damaging Het
Olfr945 A C 9: 39,258,630 L14W probably damaging Het
Olfr968 A G 9: 39,772,173 I209T probably benign Het
Paf1 T C 7: 28,396,925 probably null Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Prkcq T C 2: 11,246,793 probably benign Het
Proser3 G T 7: 30,543,499 P218T probably damaging Het
Rccd1 G A 7: 80,320,671 S66F probably benign Het
Samd15 G T 12: 87,200,760 G73V probably benign Het
Siglec1 T C 2: 131,081,439 N462S probably benign Het
Skiv2l2 A C 13: 112,910,979 Y277* probably null Het
Syne2 G T 12: 75,930,665 A1296S probably damaging Het
Tlk1 T C 2: 70,721,701 E542G possibly damaging Het
Tnks1bp1 C T 2: 85,062,411 T232I probably benign Het
Tnrc6c T A 11: 117,760,738 Y1696N probably damaging Het
Uggt1 A G 1: 36,162,353 I1102T probably benign Het
Vmn1r84 C T 7: 12,361,957 V270M probably damaging Het
Wasf1 C T 10: 40,936,195 P327S unknown Het
Other mutations in Recql
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Recql APN 6 142376921 missense probably null 0.34
IGL01933:Recql APN 6 142364638 missense probably benign 0.33
IGL02026:Recql APN 6 142366668 nonsense probably null
IGL03181:Recql APN 6 142378192 missense probably benign 0.00
R0380:Recql UTSW 6 142369430 missense probably damaging 1.00
R1371:Recql UTSW 6 142372875 missense probably damaging 0.99
R1742:Recql UTSW 6 142364572 missense probably damaging 1.00
R1780:Recql UTSW 6 142364598 missense probably benign 0.00
R1921:Recql UTSW 6 142365589 missense probably benign 0.41
R2032:Recql UTSW 6 142367283 missense probably damaging 1.00
R2966:Recql UTSW 6 142363587 missense probably benign 0.10
R4666:Recql UTSW 6 142376841 missense probably damaging 1.00
R4779:Recql UTSW 6 142363700 intron probably benign
R4863:Recql UTSW 6 142359006 utr 3 prime probably benign
R5115:Recql UTSW 6 142358559 utr 3 prime probably benign
R5400:Recql UTSW 6 142362347 intron probably benign
R5781:Recql UTSW 6 142365618 splice site probably null
R5981:Recql UTSW 6 142372878 missense probably damaging 1.00
R6372:Recql UTSW 6 142376840 missense probably damaging 1.00
R6651:Recql UTSW 6 142364434 critical splice donor site probably null
R6786:Recql UTSW 6 142364552 missense probably benign 0.43
R7399:Recql UTSW 6 142374884 missense probably damaging 1.00
R7515:Recql UTSW 6 142374885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAATATCTGCCTGCAAGTTCCCC -3'
(R):5'- TCCCTACGTGTTGAATGAACCACTG -3'

Sequencing Primer
(F):5'- TGCAAGTTCCCCATGCCAG -3'
(R):5'- GAGGTTCTGACTCTAGAACATGCTC -3'
Posted On2013-09-03