Incidental Mutation 'R8810:Etnk2'
ID 672314
Institutional Source Beutler Lab
Gene Symbol Etnk2
Ensembl Gene ENSMUSG00000070644
Gene Name ethanolamine kinase 2
Synonyms 4933417N20Rik, Eki2
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.359) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 133363572-133380336 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 133378494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 353 (Y353N)
Ref Sequence ENSEMBL: ENSMUSP00000114272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129213] [ENSMUST00000135222] [ENSMUST00000144386] [ENSMUST00000153799]
AlphaFold A7MCT6
Predicted Effect probably benign
Transcript: ENSMUST00000129213
AA Change: Y250N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000122244
Gene: ENSMUSG00000070644
AA Change: Y250N

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 200 4.7e-64 PFAM
Pfam:APH 2 227 2.2e-21 PFAM
Pfam:EcKinase 58 211 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135222
AA Change: Y353N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000114272
Gene: ENSMUSG00000070644
AA Change: Y353N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 84 331 1e-19 PFAM
Pfam:Choline_kinase 104 303 2.7e-64 PFAM
Pfam:EcKinase 163 313 2.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144386
SMART Domains Protein: ENSMUSP00000122980
Gene: ENSMUSG00000070643

DomainStartEndE-ValueType
coiled coil region 153 197 N/A INTRINSIC
HMG 396 466 3.09e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153799
SMART Domains Protein: ENSMUSP00000119729
Gene: ENSMUSG00000070643

DomainStartEndE-ValueType
coiled coil region 153 199 N/A INTRINSIC
HMG 397 467 3.09e-27 SMART
low complexity region 575 589 N/A INTRINSIC
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of choline/ethanolamine kinase family which catalyzes the first step of phosphatidylethanolamine (PtdEtn) biosynthesis via the cytidine diphosphate (CDP) ethanolamine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous mutation of this gene results in maternal-specific intrauterine growth retardation resulting in reduced litter size and perinatal lethality due to extensive placental thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,704 S1408P probably damaging Het
Acap3 T C 4: 155,905,712 V783A probably damaging Het
Akap8 T C 17: 32,306,530 N525S probably damaging Het
Aqp1 C T 6: 55,336,621 T44M probably damaging Het
Arap1 T C 7: 101,404,378 Y1305H probably damaging Het
Atg2a T G 19: 6,250,621 S743A probably benign Het
AW551984 G T 9: 39,600,011 L133I probably damaging Het
Bahcc1 C A 11: 120,273,761 P802T possibly damaging Het
Brd8 C A 18: 34,609,949 V288L probably benign Het
Carmil2 T C 8: 105,686,315 probably null Het
Catspere2 G A 1: 178,077,482 E153K possibly damaging Het
Ccdc162 C T 10: 41,666,741 R379Q probably benign Het
Cdh16 A G 8: 104,614,504 L116P probably damaging Het
Cenpj A T 14: 56,558,619 H260Q possibly damaging Het
Cenpq A G 17: 40,933,136 V17A possibly damaging Het
Cep350 T C 1: 155,928,116 K1074E probably damaging Het
Chil4 C A 3: 106,201,805 C394F probably damaging Het
Chst9 T C 18: 15,717,926 I28V probably benign Het
Clasp2 C A 9: 113,899,581 N873K probably damaging Het
Clec4b2 T A 6: 123,181,310 M45K probably benign Het
Cmya5 T A 13: 93,063,540 T3427S possibly damaging Het
Cnih4 A G 1: 181,162,212 Y130C probably damaging Het
Cpne9 T A 6: 113,304,545 M529K probably damaging Het
Ctsr T A 13: 61,161,825 Y190F probably damaging Het
Cyp2j13 G A 4: 96,056,916 H351Y probably benign Het
Dixdc1 T A 9: 50,701,965 Q230L probably damaging Het
Dpep1 A T 8: 123,200,025 I226F probably benign Het
Ehd2 A G 7: 15,957,678 V243A probably benign Het
Fgg G T 3: 83,013,015 G367V probably damaging Het
Gm11639 A T 11: 104,914,895 N3076I unknown Het
Gm609 T C 16: 45,443,836 T120A probably benign Het
Gm9772 T C 17: 22,006,329 *61Q probably null Het
Grk5 T G 19: 61,089,994 D496E possibly damaging Het
Hc T C 2: 35,019,523 N915S probably benign Het
Iah1 G T 12: 21,317,387 Q31H probably benign Het
Insr T C 8: 3,169,714 D936G probably benign Het
Ints6 A C 14: 62,702,453 V596G probably benign Het
Ispd A T 12: 36,390,482 N130Y probably damaging Het
Kcnj16 A G 11: 111,024,851 D113G possibly damaging Het
Kdm4b A T 17: 56,399,771 I928F probably damaging Het
Lrrc41 C T 4: 116,075,291 probably benign Het
Lrrc8e G A 8: 4,235,070 V432I probably benign Het
Mamdc4 T C 2: 25,568,489 E336G probably benign Het
Maml2 C A 9: 13,621,622 Q711K Het
Map3k14 T C 11: 103,227,672 T563A possibly damaging Het
Mcu T A 10: 59,467,713 K101* probably null Het
Mettl22 T A 16: 8,485,928 V286E probably damaging Het
Mon2 A T 10: 123,009,611 N1396K possibly damaging Het
Mprip T C 11: 59,697,025 probably benign Het
Mrpl51 C T 6: 125,193,381 L117F probably damaging Het
Myo1d C A 11: 80,674,932 V356F probably damaging Het
Myo1d T A 11: 80,676,932 I241F probably benign Het
Naalad2 A T 9: 18,385,934 probably benign Het
Nacad T C 11: 6,602,853 T113A probably benign Het
Nrap T A 19: 56,364,411 probably benign Het
Olfr1134 T C 2: 87,656,247 I225V possibly damaging Het
Olfr1336 T C 7: 6,460,764 L85P probably damaging Het
Olfr1358 G A 10: 78,520,450 V281M possibly damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr30 T C 11: 58,455,110 T280A possibly damaging Het
Olfr661 T A 7: 104,688,180 I55N probably damaging Het
Osbpl3 T C 6: 50,351,872 D117G probably damaging Het
Parp9 C T 16: 35,953,611 R318* probably null Het
Pcdhb18 A G 18: 37,490,321 I235V probably benign Het
Pex16 T G 2: 92,379,021 probably benign Het
Piezo2 T A 18: 63,114,963 M489L probably benign Het
Pmepa1 C A 2: 173,227,835 G271V probably damaging Het
Safb A G 17: 56,603,579 E659G unknown Het
Scn9a T C 2: 66,501,666 T1289A probably damaging Het
Secisbp2l T C 2: 125,775,676 D27G possibly damaging Het
Serpina1f A G 12: 103,693,981 V14A probably benign Het
Serpinb9b C A 13: 33,029,469 T3N possibly damaging Het
Sfxn5 C T 6: 85,229,200 M315I probably benign Het
Slc9b2 A G 3: 135,329,769 D333G probably benign Het
Sostdc1 A G 12: 36,317,230 N135S possibly damaging Het
Spg11 T G 2: 122,070,944 D1505A probably damaging Het
Taar7a T C 10: 23,993,381 N34S probably benign Het
Tcerg1l C A 7: 138,209,797 R556L possibly damaging Het
Tcp11l1 T C 2: 104,688,418 K311R probably benign Het
Tepp A T 8: 95,321,255 probably benign Het
Trbv16 T G 6: 41,152,038 F52C probably damaging Het
Ttn T A 2: 76,895,672 R6073S unknown Het
Uba1y T C Y: 828,818 I542T possibly damaging Het
Vmn1r214 T C 13: 23,034,912 I192T probably benign Het
Vmn2r67 C T 7: 85,137,138 C553Y probably damaging Het
Zdhhc17 G T 10: 110,948,260 H452N possibly damaging Het
Other mutations in Etnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1123:Etnk2 UTSW 1 133373272 missense probably benign 0.00
R1551:Etnk2 UTSW 1 133373257 missense probably damaging 1.00
R1595:Etnk2 UTSW 1 133373179 missense possibly damaging 0.88
R1728:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1728:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1728:Etnk2 UTSW 1 133365816 nonsense probably null
R1728:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1728:Etnk2 UTSW 1 133376915 missense probably benign
R1729:Etnk2 UTSW 1 133363923 missense probably benign
R1729:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1729:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1729:Etnk2 UTSW 1 133365816 nonsense probably null
R1729:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1729:Etnk2 UTSW 1 133376915 missense probably benign
R1730:Etnk2 UTSW 1 133363923 missense probably benign
R1730:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1730:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1730:Etnk2 UTSW 1 133365816 nonsense probably null
R1730:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1730:Etnk2 UTSW 1 133376915 missense probably benign
R1739:Etnk2 UTSW 1 133363923 missense probably benign
R1739:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1739:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1739:Etnk2 UTSW 1 133365816 nonsense probably null
R1739:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1739:Etnk2 UTSW 1 133376915 missense probably benign
R1762:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1762:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1762:Etnk2 UTSW 1 133365816 nonsense probably null
R1762:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1762:Etnk2 UTSW 1 133376915 missense probably benign
R1762:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1783:Etnk2 UTSW 1 133363923 missense probably benign
R1783:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1783:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1783:Etnk2 UTSW 1 133365816 nonsense probably null
R1783:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1783:Etnk2 UTSW 1 133376915 missense probably benign
R1783:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1784:Etnk2 UTSW 1 133363890 missense probably benign 0.08
R1784:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1784:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1784:Etnk2 UTSW 1 133365816 nonsense probably null
R1784:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1784:Etnk2 UTSW 1 133376915 missense probably benign
R1784:Etnk2 UTSW 1 133377046 missense probably benign 0.38
R1785:Etnk2 UTSW 1 133363923 missense probably benign
R1785:Etnk2 UTSW 1 133365587 missense probably benign 0.05
R1785:Etnk2 UTSW 1 133365765 missense probably damaging 1.00
R1785:Etnk2 UTSW 1 133365816 nonsense probably null
R1785:Etnk2 UTSW 1 133365817 missense probably benign 0.08
R1785:Etnk2 UTSW 1 133376915 missense probably benign
R2089:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R2091:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R2091:Etnk2 UTSW 1 133377053 critical splice donor site probably null
R5141:Etnk2 UTSW 1 133368862 missense probably benign 0.01
R5418:Etnk2 UTSW 1 133373257 missense probably damaging 1.00
R5586:Etnk2 UTSW 1 133379305 splice site probably null
R5922:Etnk2 UTSW 1 133363885 splice site probably null
R7884:Etnk2 UTSW 1 133365700 missense possibly damaging 0.71
R8290:Etnk2 UTSW 1 133379389 makesense probably null
R8673:Etnk2 UTSW 1 133374562 missense probably damaging 1.00
X0025:Etnk2 UTSW 1 133373239 missense probably damaging 1.00
X0026:Etnk2 UTSW 1 133365670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTTACAAGTAGGCAGTAAG -3'
(R):5'- CACTAGGTTTGGTGGAGCTC -3'

Sequencing Primer
(F):5'- AAGTCCTGTCCAGTGGTCCAG -3'
(R):5'- TTTGGTGGAGCTCCCCAG -3'
Posted On 2021-04-30