Mutagenetix > Incidental Mutation

Incidental Mutation 'R8810:Secisbp2l'

672325

Institutional Source

Beutler Lab

Gene Symbol

Secisbp2l

Ensembl Gene

ENSMUSG00000035093

Gene Name

SECIS binding protein 2-like

Synonyms

3110001I20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R8810 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125736986-125782870 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125775676 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 27 (D27G)

Ref Sequence

ENSEMBL: ENSMUSP00000055772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053699]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053699
AA Change: D27G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: D27G

Domain	Start	End	E-Value	Type
low complexity region	441	459	N/A	INTRINSIC
low complexity region	555	568	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	700	802	7.6e-24	PFAM
low complexity region	821	831	N/A	INTRINSIC
low complexity region	970	978	N/A	INTRINSIC
low complexity region	985	996	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

99% (82/83)

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,704	S1408P	probably damaging	Het
Acap3	T	C	4: 155,905,712	V783A	probably damaging	Het
Akap8	T	C	17: 32,306,530	N525S	probably damaging	Het
Aqp1	C	T	6: 55,336,621	T44M	probably damaging	Het
Arap1	T	C	7: 101,404,378	Y1305H	probably damaging	Het
Atg2a	T	G	19: 6,250,621	S743A	probably benign	Het
AW551984	G	T	9: 39,600,011	L133I	probably damaging	Het
Bahcc1	C	A	11: 120,273,761	P802T	possibly damaging	Het
Brd8	C	A	18: 34,609,949	V288L	probably benign	Het
Carmil2	T	C	8: 105,686,315		probably null	Het
Catspere2	G	A	1: 178,077,482	E153K	possibly damaging	Het
Ccdc162	C	T	10: 41,666,741	R379Q	probably benign	Het
Cdh16	A	G	8: 104,614,504	L116P	probably damaging	Het
Cenpj	A	T	14: 56,558,619	H260Q	possibly damaging	Het
Cenpq	A	G	17: 40,933,136	V17A	possibly damaging	Het
Cep350	T	C	1: 155,928,116	K1074E	probably damaging	Het
Chil4	C	A	3: 106,201,805	C394F	probably damaging	Het
Chst9	T	C	18: 15,717,926	I28V	probably benign	Het
Clasp2	C	A	9: 113,899,581	N873K	probably damaging	Het
Clec4b2	T	A	6: 123,181,310	M45K	probably benign	Het
Cmya5	T	A	13: 93,063,540	T3427S	possibly damaging	Het
Cnih4	A	G	1: 181,162,212	Y130C	probably damaging	Het
Cpne9	T	A	6: 113,304,545	M529K	probably damaging	Het
Ctsr	T	A	13: 61,161,825	Y190F	probably damaging	Het
Cyp2j13	G	A	4: 96,056,916	H351Y	probably benign	Het
Dixdc1	T	A	9: 50,701,965	Q230L	probably damaging	Het
Dpep1	A	T	8: 123,200,025	I226F	probably benign	Het
Ehd2	A	G	7: 15,957,678	V243A	probably benign	Het
Etnk2	T	A	1: 133,378,494	Y353N	probably benign	Het
Fgg	G	T	3: 83,013,015	G367V	probably damaging	Het
Gm11639	A	T	11: 104,914,895	N3076I	unknown	Het
Gm609	T	C	16: 45,443,836	T120A	probably benign	Het
Gm9772	T	C	17: 22,006,329	*61Q	probably null	Het
Grk5	T	G	19: 61,089,994	D496E	possibly damaging	Het
Hc	T	C	2: 35,019,523	N915S	probably benign	Het
Iah1	G	T	12: 21,317,387	Q31H	probably benign	Het
Insr	T	C	8: 3,169,714	D936G	probably benign	Het
Ints6	A	C	14: 62,702,453	V596G	probably benign	Het
Ispd	A	T	12: 36,390,482	N130Y	probably damaging	Het
Kcnj16	A	G	11: 111,024,851	D113G	possibly damaging	Het
Kdm4b	A	T	17: 56,399,771	I928F	probably damaging	Het
Lrrc41	C	T	4: 116,075,291		probably benign	Het
Lrrc8e	G	A	8: 4,235,070	V432I	probably benign	Het
Mamdc4	T	C	2: 25,568,489	E336G	probably benign	Het
Maml2	C	A	9: 13,621,622	Q711K		Het
Map3k14	T	C	11: 103,227,672	T563A	possibly damaging	Het
Mcu	T	A	10: 59,467,713	K101*	probably null	Het
Mettl22	T	A	16: 8,485,928	V286E	probably damaging	Het
Mon2	A	T	10: 123,009,611	N1396K	possibly damaging	Het
Mprip	T	C	11: 59,697,025		probably benign	Het
Mrpl51	C	T	6: 125,193,381	L117F	probably damaging	Het
Myo1d	C	A	11: 80,674,932	V356F	probably damaging	Het
Myo1d	T	A	11: 80,676,932	I241F	probably benign	Het
Naalad2	A	T	9: 18,385,934		probably benign	Het
Nacad	T	C	11: 6,602,853	T113A	probably benign	Het
Nrap	T	A	19: 56,364,411		probably benign	Het
Olfr1134	T	C	2: 87,656,247	I225V	possibly damaging	Het
Olfr1336	T	C	7: 6,460,764	L85P	probably damaging	Het
Olfr1358	G	A	10: 78,520,450	V281M	possibly damaging	Het
Olfr290	T	A	7: 84,916,418	I213N	possibly damaging	Het
Olfr30	T	C	11: 58,455,110	T280A	possibly damaging	Het
Olfr661	T	A	7: 104,688,180	I55N	probably damaging	Het
Osbpl3	T	C	6: 50,351,872	D117G	probably damaging	Het
Parp9	C	T	16: 35,953,611	R318*	probably null	Het
Pcdhb18	A	G	18: 37,490,321	I235V	probably benign	Het
Pex16	T	G	2: 92,379,021		probably benign	Het
Piezo2	T	A	18: 63,114,963	M489L	probably benign	Het
Pmepa1	C	A	2: 173,227,835	G271V	probably damaging	Het
Safb	A	G	17: 56,603,579	E659G	unknown	Het
Scn9a	T	C	2: 66,501,666	T1289A	probably damaging	Het
Serpina1f	A	G	12: 103,693,981	V14A	probably benign	Het
Serpinb9b	C	A	13: 33,029,469	T3N	possibly damaging	Het
Sfxn5	C	T	6: 85,229,200	M315I	probably benign	Het
Slc9b2	A	G	3: 135,329,769	D333G	probably benign	Het
Sostdc1	A	G	12: 36,317,230	N135S	possibly damaging	Het
Spg11	T	G	2: 122,070,944	D1505A	probably damaging	Het
Taar7a	T	C	10: 23,993,381	N34S	probably benign	Het
Tcerg1l	C	A	7: 138,209,797	R556L	possibly damaging	Het
Tcp11l1	T	C	2: 104,688,418	K311R	probably benign	Het
Tepp	A	T	8: 95,321,255		probably benign	Het
Trbv16	T	G	6: 41,152,038	F52C	probably damaging	Het
Ttn	T	A	2: 76,895,672	R6073S	unknown	Het
Uba1y	T	C	Y: 828,818	I542T	possibly damaging	Het
Vmn1r214	T	C	13: 23,034,912	I192T	probably benign	Het
Vmn2r67	C	T	7: 85,137,138	C553Y	probably damaging	Het
Zdhhc17	G	T	10: 110,948,260	H452N	possibly damaging	Het

Other mutations in Secisbp2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Secisbp2l	APN	2	125743856	missense	probably damaging	0.99
IGL00644:Secisbp2l	APN	2	125743844	missense	probably damaging	1.00
IGL01093:Secisbp2l	APN	2	125740325	missense	probably benign
IGL01621:Secisbp2l	APN	2	125773211	missense	probably benign
IGL01955:Secisbp2l	APN	2	125743812	critical splice donor site	probably null
IGL02036:Secisbp2l	APN	2	125758207	missense	probably benign
IGL02045:Secisbp2l	APN	2	125775578	missense	possibly damaging	0.82
IGL02182:Secisbp2l	APN	2	125747577	missense	probably damaging	1.00
IGL02408:Secisbp2l	APN	2	125740869	nonsense	probably null
IGL02455:Secisbp2l	APN	2	125773478	missense	possibly damaging	0.89
IGL02953:Secisbp2l	APN	2	125760274	missense	probably benign	0.36
Rift	UTSW	2	125768193	missense	probably damaging	1.00
Seismic	UTSW	2	125745909	missense	probably damaging	1.00
R0097:Secisbp2l	UTSW	2	125771456	missense	probably damaging	0.96
R0097:Secisbp2l	UTSW	2	125771456	missense	probably damaging	0.96
R1415:Secisbp2l	UTSW	2	125740365	missense	probably benign	0.00
R1626:Secisbp2l	UTSW	2	125775686	missense	probably damaging	0.99
R1926:Secisbp2l	UTSW	2	125740677	missense	probably damaging	0.99
R1940:Secisbp2l	UTSW	2	125740339	missense	probably damaging	1.00
R1970:Secisbp2l	UTSW	2	125747510	missense	probably damaging	1.00
R2100:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2240:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2252:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2253:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2472:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2474:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2475:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2990:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2993:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3113:Secisbp2l	UTSW	2	125750286	missense	probably damaging	1.00
R3696:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3749:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3750:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3800:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3810:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3812:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3815:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3816:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3817:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3880:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4077:Secisbp2l	UTSW	2	125751865	splice site	probably benign
R4096:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4097:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4164:Secisbp2l	UTSW	2	125751883	intron	probably benign
R4332:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4418:Secisbp2l	UTSW	2	125752915	missense	probably benign	0.00
R4598:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4600:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4602:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4603:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4678:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4679:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4684:Secisbp2l	UTSW	2	125745942	missense	probably damaging	1.00
R4741:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4749:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4934:Secisbp2l	UTSW	2	125740489	missense	probably damaging	0.99
R5245:Secisbp2l	UTSW	2	125747591	missense	probably damaging	1.00
R5521:Secisbp2l	UTSW	2	125752977	missense	possibly damaging	0.94
R5547:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5630:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5631:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5632:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R6039:Secisbp2l	UTSW	2	125773216	missense	probably benign	0.28
R6039:Secisbp2l	UTSW	2	125773216	missense	probably benign	0.28
R6378:Secisbp2l	UTSW	2	125768325	missense	possibly damaging	0.78
R6616:Secisbp2l	UTSW	2	125768226	missense	probably damaging	0.96
R6938:Secisbp2l	UTSW	2	125750352	missense	probably damaging	1.00
R7287:Secisbp2l	UTSW	2	125740369	missense	probably benign
R7373:Secisbp2l	UTSW	2	125757271	missense	probably damaging	0.99
R7403:Secisbp2l	UTSW	2	125760279	missense	possibly damaging	0.73
R7484:Secisbp2l	UTSW	2	125771532	nonsense	probably null
R7504:Secisbp2l	UTSW	2	125758171	missense	probably benign	0.30
R7762:Secisbp2l	UTSW	2	125768193	missense	probably damaging	1.00
R7769:Secisbp2l	UTSW	2	125771545	critical splice acceptor site	probably benign
R8018:Secisbp2l	UTSW	2	125745909	missense	probably damaging	1.00
R8487:Secisbp2l	UTSW	2	125775582	nonsense	probably null
R8784:Secisbp2l	UTSW	2	125760343	nonsense	probably null
R8872:Secisbp2l	UTSW	2	125752972	missense	probably benign
R9111:Secisbp2l	UTSW	2	125760286	missense	probably benign
R9154:Secisbp2l	UTSW	2	125775703	missense	probably damaging	1.00
R9155:Secisbp2l	UTSW	2	125775703	missense	probably damaging	1.00
R9589:Secisbp2l	UTSW	2	125747505	missense	probably benign	0.03
R9589:Secisbp2l	UTSW	2	125747510	missense	probably damaging	1.00
R9592:Secisbp2l	UTSW	2	125740641	missense	probably damaging	1.00
R9602:Secisbp2l	UTSW	2	125767436	missense	probably benign	0.19
R9620:Secisbp2l	UTSW	2	125747474	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTACATGGCCAAGGTCTATCTC -3'
(R):5'- ATTTCGTTCCAGCGCTGTGG -3'

Sequencing Primer
(F):5'- ATGGCCAAGGTCTATCTCCTACC -3'
(R):5'- GGGTACTCGCTTACTTTAGACTGAC -3'

Posted On

2021-04-30