Incidental Mutation 'R8810:Pmepa1'
ID 672326
Institutional Source Beutler Lab
Gene Symbol Pmepa1
Ensembl Gene ENSMUSG00000038400
Gene Name prostate transmembrane protein, androgen induced 1
Synonyms N4wbp4, Tmepai, 2210418I02Rik, PMEPA1, STAG1
MMRRC Submission 068725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 173066251-173118326 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 173069628 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 271 (G271V)
Ref Sequence ENSEMBL: ENSMUSP00000039950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036248] [ENSMUST00000139306]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000036248
AA Change: G271V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039950
Gene: ENSMUSG00000038400
AA Change: G271V

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139306
SMART Domains Protein: ENSMUSP00000115534
Gene: ENSMUSG00000038400

DomainStartEndE-ValueType
transmembrane domain 75 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 78,749,452 (GRCm39) S1408P probably damaging Het
Acap3 T C 4: 155,990,169 (GRCm39) V783A probably damaging Het
Akap8 T C 17: 32,525,504 (GRCm39) N525S probably damaging Het
Aqp1 C T 6: 55,313,606 (GRCm39) T44M probably damaging Het
Arap1 T C 7: 101,053,585 (GRCm39) Y1305H probably damaging Het
Atg2a T G 19: 6,300,651 (GRCm39) S743A probably benign Het
AW551984 G T 9: 39,511,307 (GRCm39) L133I probably damaging Het
Bahcc1 C A 11: 120,164,587 (GRCm39) P802T possibly damaging Het
Brd8 C A 18: 34,743,002 (GRCm39) V288L probably benign Het
Carmil2 T C 8: 106,412,947 (GRCm39) probably null Het
Catspere2 G A 1: 177,905,048 (GRCm39) E153K possibly damaging Het
Ccdc162 C T 10: 41,542,737 (GRCm39) R379Q probably benign Het
Cd200l1 T C 16: 45,264,199 (GRCm39) T120A probably benign Het
Cdh16 A G 8: 105,341,136 (GRCm39) L116P probably damaging Het
Cenpj A T 14: 56,796,076 (GRCm39) H260Q possibly damaging Het
Cenpq A G 17: 41,244,027 (GRCm39) V17A possibly damaging Het
Cep350 T C 1: 155,803,862 (GRCm39) K1074E probably damaging Het
Chil4 C A 3: 106,109,121 (GRCm39) C394F probably damaging Het
Chst9 T C 18: 15,850,983 (GRCm39) I28V probably benign Het
Clasp2 C A 9: 113,728,649 (GRCm39) N873K probably damaging Het
Clec4b2 T A 6: 123,158,269 (GRCm39) M45K probably benign Het
Cmya5 T A 13: 93,200,048 (GRCm39) T3427S possibly damaging Het
Cnih4 A G 1: 180,989,777 (GRCm39) Y130C probably damaging Het
Cpne9 T A 6: 113,281,506 (GRCm39) M529K probably damaging Het
Crppa A T 12: 36,440,481 (GRCm39) N130Y probably damaging Het
Ctsr T A 13: 61,309,639 (GRCm39) Y190F probably damaging Het
Cyp2j13 G A 4: 95,945,153 (GRCm39) H351Y probably benign Het
Dixdc1 T A 9: 50,613,265 (GRCm39) Q230L probably damaging Het
Dpep1 A T 8: 123,926,764 (GRCm39) I226F probably benign Het
Efcab3 A T 11: 104,805,721 (GRCm39) N3076I unknown Het
Ehd2 A G 7: 15,691,603 (GRCm39) V243A probably benign Het
Etnk2 T A 1: 133,306,232 (GRCm39) Y353N probably benign Het
Fgg G T 3: 82,920,322 (GRCm39) G367V probably damaging Het
Gm9772 T C 17: 22,225,310 (GRCm39) *61Q probably null Het
Grk5 T G 19: 61,078,432 (GRCm39) D496E possibly damaging Het
Hc T C 2: 34,909,535 (GRCm39) N915S probably benign Het
Iah1 G T 12: 21,367,388 (GRCm39) Q31H probably benign Het
Insr T C 8: 3,219,714 (GRCm39) D936G probably benign Het
Ints6 A C 14: 62,939,902 (GRCm39) V596G probably benign Het
Kcnj16 A G 11: 110,915,677 (GRCm39) D113G possibly damaging Het
Kdm4b A T 17: 56,706,771 (GRCm39) I928F probably damaging Het
Lrrc41 C T 4: 115,932,488 (GRCm39) probably benign Het
Lrrc8e G A 8: 4,285,070 (GRCm39) V432I probably benign Het
Mamdc4 T C 2: 25,458,501 (GRCm39) E336G probably benign Het
Maml2 C A 9: 13,532,918 (GRCm39) Q711K Het
Map3k14 T C 11: 103,118,498 (GRCm39) T563A possibly damaging Het
Mcu T A 10: 59,303,535 (GRCm39) K101* probably null Het
Mettl22 T A 16: 8,303,792 (GRCm39) V286E probably damaging Het
Mon2 A T 10: 122,845,516 (GRCm39) N1396K possibly damaging Het
Mprip T C 11: 59,587,851 (GRCm39) probably benign Het
Mrpl51 C T 6: 125,170,344 (GRCm39) L117F probably damaging Het
Myo1d C A 11: 80,565,758 (GRCm39) V356F probably damaging Het
Myo1d T A 11: 80,567,758 (GRCm39) I241F probably benign Het
Naalad2 A T 9: 18,297,230 (GRCm39) probably benign Het
Nacad T C 11: 6,552,853 (GRCm39) T113A probably benign Het
Nrap T A 19: 56,352,843 (GRCm39) probably benign Het
Or10b1 G A 10: 78,356,284 (GRCm39) V281M possibly damaging Het
Or2z2 T C 11: 58,345,936 (GRCm39) T280A possibly damaging Het
Or56b2 T A 7: 104,337,387 (GRCm39) I55N probably damaging Het
Or5ae1 T A 7: 84,565,626 (GRCm39) I213N possibly damaging Het
Or5w1 T C 2: 87,486,591 (GRCm39) I225V possibly damaging Het
Or6z3 T C 7: 6,463,763 (GRCm39) L85P probably damaging Het
Osbpl3 T C 6: 50,328,852 (GRCm39) D117G probably damaging Het
Parp9 C T 16: 35,773,981 (GRCm39) R318* probably null Het
Pcdhb18 A G 18: 37,623,374 (GRCm39) I235V probably benign Het
Pex16 T G 2: 92,209,366 (GRCm39) probably benign Het
Piezo2 T A 18: 63,248,034 (GRCm39) M489L probably benign Het
Safb A G 17: 56,910,579 (GRCm39) E659G unknown Het
Scn9a T C 2: 66,332,010 (GRCm39) T1289A probably damaging Het
Secisbp2l T C 2: 125,617,596 (GRCm39) D27G possibly damaging Het
Serpina1f A G 12: 103,660,240 (GRCm39) V14A probably benign Het
Serpinb9b C A 13: 33,213,452 (GRCm39) T3N possibly damaging Het
Sfxn5 C T 6: 85,206,182 (GRCm39) M315I probably benign Het
Slc9b2 A G 3: 135,035,530 (GRCm39) D333G probably benign Het
Sostdc1 A G 12: 36,367,229 (GRCm39) N135S possibly damaging Het
Spg11 T G 2: 121,901,425 (GRCm39) D1505A probably damaging Het
Spmip8 A T 8: 96,047,883 (GRCm39) probably benign Het
Taar7a T C 10: 23,869,279 (GRCm39) N34S probably benign Het
Tcerg1l C A 7: 137,811,526 (GRCm39) R556L possibly damaging Het
Tcp11l1 T C 2: 104,518,763 (GRCm39) K311R probably benign Het
Trbv16 T G 6: 41,128,972 (GRCm39) F52C probably damaging Het
Ttn T A 2: 76,726,016 (GRCm39) R6073S unknown Het
Uba1y T C Y: 828,818 (GRCm39) I542T possibly damaging Het
Vmn1r214 T C 13: 23,219,082 (GRCm39) I192T probably benign Het
Vmn2r67 C T 7: 84,786,346 (GRCm39) C553Y probably damaging Het
Zdhhc17 G T 10: 110,784,121 (GRCm39) H452N possibly damaging Het
Other mutations in Pmepa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1401:Pmepa1 UTSW 2 173,070,368 (GRCm39) critical splice donor site probably null
R1439:Pmepa1 UTSW 2 173,069,874 (GRCm39) missense probably benign 0.13
R1772:Pmepa1 UTSW 2 173,076,153 (GRCm39) missense probably damaging 1.00
R2228:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2229:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2380:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2381:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2382:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2385:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2386:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R3783:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R3784:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R3785:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R3787:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R4600:Pmepa1 UTSW 2 173,070,120 (GRCm39) missense possibly damaging 0.81
R5368:Pmepa1 UTSW 2 173,070,115 (GRCm39) missense probably damaging 1.00
R5982:Pmepa1 UTSW 2 173,076,105 (GRCm39) missense possibly damaging 0.82
R7371:Pmepa1 UTSW 2 173,076,212 (GRCm39) missense possibly damaging 0.73
R7640:Pmepa1 UTSW 2 173,117,956 (GRCm39) missense probably benign 0.02
R8221:Pmepa1 UTSW 2 173,069,700 (GRCm39) missense probably damaging 1.00
R9227:Pmepa1 UTSW 2 173,117,962 (GRCm39) missense probably benign 0.06
R9228:Pmepa1 UTSW 2 173,117,962 (GRCm39) missense probably benign 0.06
R9229:Pmepa1 UTSW 2 173,117,962 (GRCm39) missense probably benign 0.06
R9260:Pmepa1 UTSW 2 173,117,943 (GRCm39) small deletion probably benign
R9568:Pmepa1 UTSW 2 173,069,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCATTCAGACCACACAG -3'
(R):5'- TTCGACAGTGACCTTATAGACAGC -3'

Sequencing Primer
(F):5'- TGCATTCAGACCACACAGAACATG -3'
(R):5'- GTGACCTTATAGACAGCACCATG -3'
Posted On 2021-04-30