Incidental Mutation 'R8810:Chil4'
ID 672328
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Name chitinase-like 4
Synonyms Chi3l4, Ym2
MMRRC Submission 068725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 106108807-106126795 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 106109121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 394 (C394F)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
AlphaFold Q91Z98
Predicted Effect probably damaging
Transcript: ENSMUST00000082219
AA Change: C394F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: C394F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 78,749,452 (GRCm39) S1408P probably damaging Het
Acap3 T C 4: 155,990,169 (GRCm39) V783A probably damaging Het
Akap8 T C 17: 32,525,504 (GRCm39) N525S probably damaging Het
Aqp1 C T 6: 55,313,606 (GRCm39) T44M probably damaging Het
Arap1 T C 7: 101,053,585 (GRCm39) Y1305H probably damaging Het
Atg2a T G 19: 6,300,651 (GRCm39) S743A probably benign Het
AW551984 G T 9: 39,511,307 (GRCm39) L133I probably damaging Het
Bahcc1 C A 11: 120,164,587 (GRCm39) P802T possibly damaging Het
Brd8 C A 18: 34,743,002 (GRCm39) V288L probably benign Het
Carmil2 T C 8: 106,412,947 (GRCm39) probably null Het
Catspere2 G A 1: 177,905,048 (GRCm39) E153K possibly damaging Het
Ccdc162 C T 10: 41,542,737 (GRCm39) R379Q probably benign Het
Cd200l1 T C 16: 45,264,199 (GRCm39) T120A probably benign Het
Cdh16 A G 8: 105,341,136 (GRCm39) L116P probably damaging Het
Cenpj A T 14: 56,796,076 (GRCm39) H260Q possibly damaging Het
Cenpq A G 17: 41,244,027 (GRCm39) V17A possibly damaging Het
Cep350 T C 1: 155,803,862 (GRCm39) K1074E probably damaging Het
Chst9 T C 18: 15,850,983 (GRCm39) I28V probably benign Het
Clasp2 C A 9: 113,728,649 (GRCm39) N873K probably damaging Het
Clec4b2 T A 6: 123,158,269 (GRCm39) M45K probably benign Het
Cmya5 T A 13: 93,200,048 (GRCm39) T3427S possibly damaging Het
Cnih4 A G 1: 180,989,777 (GRCm39) Y130C probably damaging Het
Cpne9 T A 6: 113,281,506 (GRCm39) M529K probably damaging Het
Crppa A T 12: 36,440,481 (GRCm39) N130Y probably damaging Het
Ctsr T A 13: 61,309,639 (GRCm39) Y190F probably damaging Het
Cyp2j13 G A 4: 95,945,153 (GRCm39) H351Y probably benign Het
Dixdc1 T A 9: 50,613,265 (GRCm39) Q230L probably damaging Het
Dpep1 A T 8: 123,926,764 (GRCm39) I226F probably benign Het
Efcab3 A T 11: 104,805,721 (GRCm39) N3076I unknown Het
Ehd2 A G 7: 15,691,603 (GRCm39) V243A probably benign Het
Etnk2 T A 1: 133,306,232 (GRCm39) Y353N probably benign Het
Fgg G T 3: 82,920,322 (GRCm39) G367V probably damaging Het
Gm9772 T C 17: 22,225,310 (GRCm39) *61Q probably null Het
Grk5 T G 19: 61,078,432 (GRCm39) D496E possibly damaging Het
Hc T C 2: 34,909,535 (GRCm39) N915S probably benign Het
Iah1 G T 12: 21,367,388 (GRCm39) Q31H probably benign Het
Insr T C 8: 3,219,714 (GRCm39) D936G probably benign Het
Ints6 A C 14: 62,939,902 (GRCm39) V596G probably benign Het
Kcnj16 A G 11: 110,915,677 (GRCm39) D113G possibly damaging Het
Kdm4b A T 17: 56,706,771 (GRCm39) I928F probably damaging Het
Lrrc41 C T 4: 115,932,488 (GRCm39) probably benign Het
Lrrc8e G A 8: 4,285,070 (GRCm39) V432I probably benign Het
Mamdc4 T C 2: 25,458,501 (GRCm39) E336G probably benign Het
Maml2 C A 9: 13,532,918 (GRCm39) Q711K Het
Map3k14 T C 11: 103,118,498 (GRCm39) T563A possibly damaging Het
Mcu T A 10: 59,303,535 (GRCm39) K101* probably null Het
Mettl22 T A 16: 8,303,792 (GRCm39) V286E probably damaging Het
Mon2 A T 10: 122,845,516 (GRCm39) N1396K possibly damaging Het
Mprip T C 11: 59,587,851 (GRCm39) probably benign Het
Mrpl51 C T 6: 125,170,344 (GRCm39) L117F probably damaging Het
Myo1d C A 11: 80,565,758 (GRCm39) V356F probably damaging Het
Myo1d T A 11: 80,567,758 (GRCm39) I241F probably benign Het
Naalad2 A T 9: 18,297,230 (GRCm39) probably benign Het
Nacad T C 11: 6,552,853 (GRCm39) T113A probably benign Het
Nrap T A 19: 56,352,843 (GRCm39) probably benign Het
Or10b1 G A 10: 78,356,284 (GRCm39) V281M possibly damaging Het
Or2z2 T C 11: 58,345,936 (GRCm39) T280A possibly damaging Het
Or56b2 T A 7: 104,337,387 (GRCm39) I55N probably damaging Het
Or5ae1 T A 7: 84,565,626 (GRCm39) I213N possibly damaging Het
Or5w1 T C 2: 87,486,591 (GRCm39) I225V possibly damaging Het
Or6z3 T C 7: 6,463,763 (GRCm39) L85P probably damaging Het
Osbpl3 T C 6: 50,328,852 (GRCm39) D117G probably damaging Het
Parp9 C T 16: 35,773,981 (GRCm39) R318* probably null Het
Pcdhb18 A G 18: 37,623,374 (GRCm39) I235V probably benign Het
Pex16 T G 2: 92,209,366 (GRCm39) probably benign Het
Piezo2 T A 18: 63,248,034 (GRCm39) M489L probably benign Het
Pmepa1 C A 2: 173,069,628 (GRCm39) G271V probably damaging Het
Safb A G 17: 56,910,579 (GRCm39) E659G unknown Het
Scn9a T C 2: 66,332,010 (GRCm39) T1289A probably damaging Het
Secisbp2l T C 2: 125,617,596 (GRCm39) D27G possibly damaging Het
Serpina1f A G 12: 103,660,240 (GRCm39) V14A probably benign Het
Serpinb9b C A 13: 33,213,452 (GRCm39) T3N possibly damaging Het
Sfxn5 C T 6: 85,206,182 (GRCm39) M315I probably benign Het
Slc9b2 A G 3: 135,035,530 (GRCm39) D333G probably benign Het
Sostdc1 A G 12: 36,367,229 (GRCm39) N135S possibly damaging Het
Spg11 T G 2: 121,901,425 (GRCm39) D1505A probably damaging Het
Spmip8 A T 8: 96,047,883 (GRCm39) probably benign Het
Taar7a T C 10: 23,869,279 (GRCm39) N34S probably benign Het
Tcerg1l C A 7: 137,811,526 (GRCm39) R556L possibly damaging Het
Tcp11l1 T C 2: 104,518,763 (GRCm39) K311R probably benign Het
Trbv16 T G 6: 41,128,972 (GRCm39) F52C probably damaging Het
Ttn T A 2: 76,726,016 (GRCm39) R6073S unknown Het
Uba1y T C Y: 828,818 (GRCm39) I542T possibly damaging Het
Vmn1r214 T C 13: 23,219,082 (GRCm39) I192T probably benign Het
Vmn2r67 C T 7: 84,786,346 (GRCm39) C553Y probably damaging Het
Zdhhc17 G T 10: 110,784,121 (GRCm39) H452N possibly damaging Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106,109,113 (GRCm39) missense probably benign
IGL02457:Chil4 APN 3 106,121,715 (GRCm39) missense probably benign
R1087:Chil4 UTSW 3 106,117,881 (GRCm39) missense probably benign 0.01
R1398:Chil4 UTSW 3 106,126,825 (GRCm39) splice site probably null
R1503:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign
R1553:Chil4 UTSW 3 106,111,006 (GRCm39) missense probably benign 0.02
R1806:Chil4 UTSW 3 106,117,959 (GRCm39) splice site probably benign
R1873:Chil4 UTSW 3 106,113,414 (GRCm39) missense probably benign 0.00
R2069:Chil4 UTSW 3 106,126,771 (GRCm39) missense probably benign 0.16
R2100:Chil4 UTSW 3 106,121,663 (GRCm39) missense probably benign
R2370:Chil4 UTSW 3 106,121,616 (GRCm39) nonsense probably null
R2984:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106,111,056 (GRCm39) missense probably benign 0.08
R3919:Chil4 UTSW 3 106,109,848 (GRCm39) missense probably benign 0.00
R4033:Chil4 UTSW 3 106,121,765 (GRCm39) missense probably damaging 1.00
R4181:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106,110,144 (GRCm39) missense probably benign
R4391:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106,121,678 (GRCm39) missense probably damaging 1.00
R4544:Chil4 UTSW 3 106,117,922 (GRCm39) missense probably damaging 0.97
R4887:Chil4 UTSW 3 106,111,460 (GRCm39) missense probably benign 0.01
R4949:Chil4 UTSW 3 106,113,408 (GRCm39) missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106,109,913 (GRCm39) missense probably damaging 1.00
R5146:Chil4 UTSW 3 106,110,150 (GRCm39) missense probably benign 0.18
R5254:Chil4 UTSW 3 106,126,768 (GRCm39) missense probably benign 0.00
R5521:Chil4 UTSW 3 106,111,013 (GRCm39) missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106,109,894 (GRCm39) missense probably benign 0.00
R5883:Chil4 UTSW 3 106,117,886 (GRCm39) missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106,121,711 (GRCm39) missense probably damaging 1.00
R6257:Chil4 UTSW 3 106,111,412 (GRCm39) missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106,111,487 (GRCm39) missense probably damaging 1.00
R6602:Chil4 UTSW 3 106,117,906 (GRCm39) missense probably benign 0.00
R7113:Chil4 UTSW 3 106,121,664 (GRCm39) missense probably benign
R7113:Chil4 UTSW 3 106,110,083 (GRCm39) missense probably damaging 1.00
R7188:Chil4 UTSW 3 106,111,475 (GRCm39) missense probably damaging 1.00
R7980:Chil4 UTSW 3 106,110,060 (GRCm39) missense probably damaging 1.00
R9300:Chil4 UTSW 3 106,109,874 (GRCm39) missense probably benign 0.10
R9307:Chil4 UTSW 3 106,111,382 (GRCm39) critical splice donor site probably null
R9529:Chil4 UTSW 3 106,118,656 (GRCm39) missense probably damaging 1.00
X0067:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGATGCTGATGCTTTGAAC -3'
(R):5'- ACTGGGATGATGTTGCAAATTCC -3'

Sequencing Primer
(F):5'- GCAAAAATGTTCAGAGCTTAGCC -3'
(R):5'- GCAAATTCCCTAAATACTATGTCTGG -3'
Posted On 2021-04-30