Incidental Mutation 'K3955:Proser3'
ID67233
Institutional Source Beutler Lab
Gene Symbol Proser3
Ensembl Gene ENSMUSG00000036864
Gene Nameproline and serine rich 3
SynonymsBC053749
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #K3955 (G3) of strain 706
Quality Score216
Status Validated
Chromosome7
Chromosomal Location30539134-30552299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30543499 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 218 (P218T)
Ref Sequence ENSEMBL: ENSMUSP00000148912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062708] [ENSMUST00000108165] [ENSMUST00000153594] [ENSMUST00000215288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062708
AA Change: P218T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059135
Gene: ENSMUSG00000036864
AA Change: P218T

DomainStartEndE-ValueType
low complexity region 33 56 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 388 407 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108165
AA Change: P218T

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103800
Gene: ENSMUSG00000036864
AA Change: P218T

DomainStartEndE-ValueType
low complexity region 33 56 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 388 407 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134113
Predicted Effect probably benign
Transcript: ENSMUST00000153594
SMART Domains Protein: ENSMUSP00000123095
Gene: ENSMUSG00000036864

DomainStartEndE-ValueType
low complexity region 33 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208842
Predicted Effect probably damaging
Transcript: ENSMUST00000215288
AA Change: P218T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1349 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 G A 1: 89,887,604 R738H probably damaging Het
Arhgap28 T C 17: 68,004,006 E2G probably damaging Het
Atad2b C A 12: 4,954,536 probably benign Het
Atmin T A 8: 116,957,036 C478* probably null Het
Calr T C 8: 84,846,273 Y57C probably damaging Het
Cdh13 G A 8: 118,675,104 V82M probably damaging Het
Ces3a A T 8: 105,050,627 probably benign Het
Dmbt1 T C 7: 131,119,564 Y1854H probably damaging Het
Dnah1 T A 14: 31,266,459 M3429L probably benign Het
Dscam A G 16: 96,673,687 F1225S probably benign Het
E030025P04Rik G A 11: 109,143,952 P37S unknown Het
Eral1 A T 11: 78,076,021 D189E probably damaging Het
Fbxw14 G T 9: 109,276,245 P284Q possibly damaging Het
Fcrl6 A G 1: 172,597,684 V260A probably benign Het
Fezf2 A T 14: 12,345,097 F30Y probably damaging Het
Gjb4 A T 4: 127,351,500 V216D probably benign Het
Gm13023 T C 4: 143,795,140 I442T possibly damaging Het
Gm9758 G A 5: 14,913,508 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gmps A C 3: 64,001,533 R485S probably damaging Het
Gtdc1 C T 2: 44,752,221 probably null Het
H2-Ob C T 17: 34,241,184 R19C probably damaging Het
Lars2 T C 9: 123,377,777 V103A probably damaging Het
Ndnf G A 6: 65,701,429 probably benign Het
Nectin1 A G 9: 43,792,078 Y211C probably damaging Het
Notch4 C T 17: 34,568,462 T332I probably damaging Het
Olfr272 A G 4: 52,911,081 F238L probably damaging Het
Olfr945 A C 9: 39,258,630 L14W probably damaging Het
Olfr968 A G 9: 39,772,173 I209T probably benign Het
Paf1 T C 7: 28,396,925 probably null Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Prkcq T C 2: 11,246,793 probably benign Het
Rccd1 G A 7: 80,320,671 S66F probably benign Het
Recql G T 6: 142,378,206 S54* probably null Het
Samd15 G T 12: 87,200,760 G73V probably benign Het
Siglec1 T C 2: 131,081,439 N462S probably benign Het
Skiv2l2 A C 13: 112,910,979 Y277* probably null Het
Syne2 G T 12: 75,930,665 A1296S probably damaging Het
Tlk1 T C 2: 70,721,701 E542G possibly damaging Het
Tnks1bp1 C T 2: 85,062,411 T232I probably benign Het
Tnrc6c T A 11: 117,760,738 Y1696N probably damaging Het
Uggt1 A G 1: 36,162,353 I1102T probably benign Het
Vmn1r84 C T 7: 12,361,957 V270M probably damaging Het
Wasf1 C T 10: 40,936,195 P327S unknown Het
Other mutations in Proser3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Proser3 APN 7 30540671 missense possibly damaging 0.62
IGL01346:Proser3 APN 7 30549646 missense probably benign 0.21
IGL02465:Proser3 APN 7 30543533 missense possibly damaging 0.87
IGL03178:Proser3 APN 7 30543609 missense probably damaging 0.99
IGL03372:Proser3 APN 7 30543568 missense probably damaging 1.00
R0008:Proser3 UTSW 7 30540138 missense probably damaging 0.99
R0008:Proser3 UTSW 7 30540138 missense probably damaging 0.99
R0255:Proser3 UTSW 7 30546417 missense probably damaging 1.00
R0627:Proser3 UTSW 7 30540783 missense probably benign 0.04
R0702:Proser3 UTSW 7 30539530 missense probably benign 0.00
R0883:Proser3 UTSW 7 30540699 missense probably damaging 0.99
R1185:Proser3 UTSW 7 30546147 missense probably benign 0.01
R1457:Proser3 UTSW 7 30539747 critical splice donor site probably null
R1650:Proser3 UTSW 7 30540326 missense probably damaging 0.99
R1697:Proser3 UTSW 7 30540021 missense probably benign 0.00
R3121:Proser3 UTSW 7 30540371 missense probably benign 0.10
R4210:Proser3 UTSW 7 30546100 intron probably benign
R4375:Proser3 UTSW 7 30540671 missense possibly damaging 0.62
R5364:Proser3 UTSW 7 30546148 missense possibly damaging 0.60
R6225:Proser3 UTSW 7 30543728 missense probably damaging 1.00
R6831:Proser3 UTSW 7 30540356 missense probably benign
R7151:Proser3 UTSW 7 30540324 missense possibly damaging 0.79
X0028:Proser3 UTSW 7 30540762 missense probably damaging 0.99
Z31818:Proser3 UTSW 7 30546365 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- tccatgtagttcaTTGTGATATACACAAAGCA -3'
(R):5'- GAAACCCCAAAAGTCAAAGCAGGAAAG -3'

Sequencing Primer
(F):5'- gccagcgggaactacac -3'
(R):5'- AGTCTGAACTCATGGAACTCGTC -3'
Posted On2013-09-03