Mutagenetix > Incidental Mutation

Incidental Mutation 'K3955:Calr'

67234

Institutional Source

Beutler Lab

Gene Symbol

Calr

Ensembl Gene

ENSMUSG00000003814

Gene Name

calreticulin

Synonyms

Calregulin, CRT

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

K3955 (G3) of strain 706

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85568717-85573560 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85572902 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 57 (Y57C)

Ref Sequence

ENSEMBL: ENSMUSP00000003912 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003912]

AlphaFold

P14211

PDB Structure

Crystal structure of the calreticulin lectin domain [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural and functional relationships between the lectin and arm domains of calreticulin [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003912
AA Change: Y57C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003912
Gene: ENSMUSG00000003814
AA Change: Y57C

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Calreticulin	23	258	2.7e-64	PFAM
Pfam:Calreticulin	257	332	3.3e-24	PFAM
low complexity region	358	407	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125998

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128028

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141347

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154774

Meta Mutation Damage Score

0.8536

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit decreased cardiac cell mass, increased apoptosis of cardiac myocytes, neural tube defects (sometimes associated with exencephaly), omphalocele, and mid- to late-gestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	G	A	1: 89,815,326 (GRCm39)	R738H	probably damaging	Het
Arhgap28	T	C	17: 68,311,001 (GRCm39)	E2G	probably damaging	Het
Atad2b	C	A	12: 5,004,536 (GRCm39)		probably benign	Het
Atmin	T	A	8: 117,683,775 (GRCm39)	C478*	probably null	Het
Cdh13	G	A	8: 119,401,843 (GRCm39)	V82M	probably damaging	Het
Ces3a	A	T	8: 105,777,259 (GRCm39)		probably benign	Het
Dmbt1	T	C	7: 130,721,293 (GRCm39)	Y1854H	probably damaging	Het
Dnah1	T	A	14: 30,988,416 (GRCm39)	M3429L	probably benign	Het
Dscam	A	G	16: 96,474,887 (GRCm39)	F1225S	probably benign	Het
E030025P04Rik	G	A	11: 109,034,778 (GRCm39)	P37S	unknown	Het
Eral1	A	T	11: 77,966,847 (GRCm39)	D189E	probably damaging	Het
Fbxw14	G	T	9: 109,105,313 (GRCm39)	P284Q	possibly damaging	Het
Fcrl6	A	G	1: 172,425,251 (GRCm39)	V260A	probably benign	Het
Fezf2	A	T	14: 12,345,097 (GRCm38)	F30Y	probably damaging	Het
Gjb4	A	T	4: 127,245,293 (GRCm39)	V216D	probably benign	Het
Gm9758	G	A	5: 14,963,522 (GRCm39)		probably benign	Het
Gm9758	C	G	5: 14,963,553 (GRCm39)	V92L	probably benign	Het
Gmps	A	C	3: 63,908,954 (GRCm39)	R485S	probably damaging	Het
Gtdc1	C	T	2: 44,642,233 (GRCm39)		probably null	Het
H2-Ob	C	T	17: 34,460,158 (GRCm39)	R19C	probably damaging	Het
Lars2	T	C	9: 123,206,842 (GRCm39)	V103A	probably damaging	Het
Mtrex	A	C	13: 113,047,513 (GRCm39)	Y277*	probably null	Het
Ndnf	G	A	6: 65,678,413 (GRCm39)		probably benign	Het
Nectin1	A	G	9: 43,703,375 (GRCm39)	Y211C	probably damaging	Het
Notch4	C	T	17: 34,787,436 (GRCm39)	T332I	probably damaging	Het
Or13c25	A	G	4: 52,911,081 (GRCm39)	F238L	probably damaging	Het
Or8g28	A	C	9: 39,169,926 (GRCm39)	L14W	probably damaging	Het
Or8g53	A	G	9: 39,683,469 (GRCm39)	I209T	probably benign	Het
Paf1	T	C	7: 28,096,350 (GRCm39)		probably null	Het
Pcdhb1	G	T	18: 37,399,026 (GRCm39)	G326C	probably damaging	Het
Plcl1	A	G	1: 55,737,098 (GRCm39)	Y813C	possibly damaging	Het
Pramel25	T	C	4: 143,521,710 (GRCm39)	I442T	possibly damaging	Het
Prkcq	T	C	2: 11,251,604 (GRCm39)		probably benign	Het
Proser3	G	T	7: 30,242,924 (GRCm39)	P218T	probably damaging	Het
Rccd1	G	A	7: 79,970,419 (GRCm39)	S66F	probably benign	Het
Recql	G	T	6: 142,323,932 (GRCm39)	S54*	probably null	Het
Samd15	G	T	12: 87,247,534 (GRCm39)	G73V	probably benign	Het
Siglec1	T	C	2: 130,923,359 (GRCm39)	N462S	probably benign	Het
Syne2	G	T	12: 75,977,439 (GRCm39)	A1296S	probably damaging	Het
Tlk1	T	C	2: 70,552,045 (GRCm39)	E542G	possibly damaging	Het
Tnks1bp1	C	T	2: 84,892,755 (GRCm39)	T232I	probably benign	Het
Tnrc6c	T	A	11: 117,651,564 (GRCm39)	Y1696N	probably damaging	Het
Uggt1	A	G	1: 36,201,434 (GRCm39)	I1102T	probably benign	Het
Vmn1r84	C	T	7: 12,095,884 (GRCm39)	V270M	probably damaging	Het
Wasf1	C	T	10: 40,812,191 (GRCm39)	P327S	unknown	Het

Other mutations in Calr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Calr	APN	8	85,571,373 (GRCm39)	missense	possibly damaging	0.89
IGL00648:Calr	APN	8	85,569,331 (GRCm39)	unclassified	probably benign
IGL01309:Calr	APN	8	85,573,335 (GRCm39)	critical splice donor site	probably null
IGL01910:Calr	APN	8	85,571,598 (GRCm39)	unclassified	probably benign
IGL01918:Calr	APN	8	85,569,479 (GRCm39)	unclassified	probably benign
IGL02399:Calr	APN	8	85,569,415 (GRCm39)	unclassified	probably benign
IGL02749:Calr	APN	8	85,571,117 (GRCm39)	missense	probably damaging	1.00
IGL02858:Calr	APN	8	85,571,528 (GRCm39)	missense	probably benign	0.07
IGL03090:Calr	APN	8	85,573,373 (GRCm39)	missense	possibly damaging	0.82
R0309:Calr	UTSW	8	85,569,660 (GRCm39)	missense	probably benign	0.43
R1670:Calr	UTSW	8	85,570,748 (GRCm39)	missense	probably benign	0.24
R1974:Calr	UTSW	8	85,570,786 (GRCm39)	missense	probably benign
R6864:Calr	UTSW	8	85,571,557 (GRCm39)	missense	probably damaging	0.98
R7120:Calr	UTSW	8	85,569,457 (GRCm39)	missense	probably damaging	0.98
R9320:Calr	UTSW	8	85,572,629 (GRCm39)	nonsense	probably null
Z1176:Calr	UTSW	8	85,570,693 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGACAGTGCGTAAAATCGGGCATC -3'
(R):5'- ACCTGCTTGTAGCTCCTGACAGAC -3'

Sequencing Primer
(F):5'- CGTAAAATCGGGCATCTTGGC -3'
(R):5'- CTCCTGACAGACGTTGGTTATG -3'

Posted On

2013-09-03