Incidental Mutation 'R8810:Ehd2'
ID 672341
Institutional Source Beutler Lab
Gene Symbol Ehd2
Ensembl Gene ENSMUSG00000074364
Gene Name EH-domain containing 2
Synonyms C130052H20Rik
MMRRC Submission 068725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.213) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 15680883-15701402 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15691603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 243 (V243A)
Ref Sequence ENSEMBL: ENSMUSP00000096397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098799] [ENSMUST00000144956]
AlphaFold Q8BH64
PDB Structure Crystal structure of an EHD ATPase involved in membrane remodelling [X-RAY DIFFRACTION]
Structural insights into the N-terminus of the EHD2 ATPase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000098799
AA Change: V243A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096397
Gene: ENSMUSG00000074364
AA Change: V243A

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 4.1e-19 PFAM
Pfam:MMR_HSR1 60 220 2.2e-7 PFAM
Pfam:Dynamin_N 61 221 2.4e-14 PFAM
EH 443 536 2.96e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144956
SMART Domains Protein: ENSMUSP00000119933
Gene: ENSMUSG00000074364

DomainStartEndE-ValueType
Pfam:MMR_HSR1 4 84 2.4e-7 PFAM
Pfam:Dynamin_N 4 85 1.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EH domain-containing protein family. These proteins are characterized by a C-terminal EF-hand domain, a nucleotide-binding consensus site at the N terminus and a bipartite nuclear localization signal. The encoded protein interacts with the actin cytoskeleton through an N-terminal domain and also binds to an EH domain-binding protein through the C-terminal EH domain. This interaction appears to connect clathrin-dependent endocytosis to actin, suggesting that this gene product participates in the endocytic pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 78,749,452 (GRCm39) S1408P probably damaging Het
Acap3 T C 4: 155,990,169 (GRCm39) V783A probably damaging Het
Akap8 T C 17: 32,525,504 (GRCm39) N525S probably damaging Het
Aqp1 C T 6: 55,313,606 (GRCm39) T44M probably damaging Het
Arap1 T C 7: 101,053,585 (GRCm39) Y1305H probably damaging Het
Atg2a T G 19: 6,300,651 (GRCm39) S743A probably benign Het
AW551984 G T 9: 39,511,307 (GRCm39) L133I probably damaging Het
Bahcc1 C A 11: 120,164,587 (GRCm39) P802T possibly damaging Het
Brd8 C A 18: 34,743,002 (GRCm39) V288L probably benign Het
Carmil2 T C 8: 106,412,947 (GRCm39) probably null Het
Catspere2 G A 1: 177,905,048 (GRCm39) E153K possibly damaging Het
Ccdc162 C T 10: 41,542,737 (GRCm39) R379Q probably benign Het
Cd200l1 T C 16: 45,264,199 (GRCm39) T120A probably benign Het
Cdh16 A G 8: 105,341,136 (GRCm39) L116P probably damaging Het
Cenpj A T 14: 56,796,076 (GRCm39) H260Q possibly damaging Het
Cenpq A G 17: 41,244,027 (GRCm39) V17A possibly damaging Het
Cep350 T C 1: 155,803,862 (GRCm39) K1074E probably damaging Het
Chil4 C A 3: 106,109,121 (GRCm39) C394F probably damaging Het
Chst9 T C 18: 15,850,983 (GRCm39) I28V probably benign Het
Clasp2 C A 9: 113,728,649 (GRCm39) N873K probably damaging Het
Clec4b2 T A 6: 123,158,269 (GRCm39) M45K probably benign Het
Cmya5 T A 13: 93,200,048 (GRCm39) T3427S possibly damaging Het
Cnih4 A G 1: 180,989,777 (GRCm39) Y130C probably damaging Het
Cpne9 T A 6: 113,281,506 (GRCm39) M529K probably damaging Het
Crppa A T 12: 36,440,481 (GRCm39) N130Y probably damaging Het
Ctsr T A 13: 61,309,639 (GRCm39) Y190F probably damaging Het
Cyp2j13 G A 4: 95,945,153 (GRCm39) H351Y probably benign Het
Dixdc1 T A 9: 50,613,265 (GRCm39) Q230L probably damaging Het
Dpep1 A T 8: 123,926,764 (GRCm39) I226F probably benign Het
Efcab3 A T 11: 104,805,721 (GRCm39) N3076I unknown Het
Etnk2 T A 1: 133,306,232 (GRCm39) Y353N probably benign Het
Fgg G T 3: 82,920,322 (GRCm39) G367V probably damaging Het
Gm9772 T C 17: 22,225,310 (GRCm39) *61Q probably null Het
Grk5 T G 19: 61,078,432 (GRCm39) D496E possibly damaging Het
Hc T C 2: 34,909,535 (GRCm39) N915S probably benign Het
Iah1 G T 12: 21,367,388 (GRCm39) Q31H probably benign Het
Insr T C 8: 3,219,714 (GRCm39) D936G probably benign Het
Ints6 A C 14: 62,939,902 (GRCm39) V596G probably benign Het
Kcnj16 A G 11: 110,915,677 (GRCm39) D113G possibly damaging Het
Kdm4b A T 17: 56,706,771 (GRCm39) I928F probably damaging Het
Lrrc41 C T 4: 115,932,488 (GRCm39) probably benign Het
Lrrc8e G A 8: 4,285,070 (GRCm39) V432I probably benign Het
Mamdc4 T C 2: 25,458,501 (GRCm39) E336G probably benign Het
Maml2 C A 9: 13,532,918 (GRCm39) Q711K Het
Map3k14 T C 11: 103,118,498 (GRCm39) T563A possibly damaging Het
Mcu T A 10: 59,303,535 (GRCm39) K101* probably null Het
Mettl22 T A 16: 8,303,792 (GRCm39) V286E probably damaging Het
Mon2 A T 10: 122,845,516 (GRCm39) N1396K possibly damaging Het
Mprip T C 11: 59,587,851 (GRCm39) probably benign Het
Mrpl51 C T 6: 125,170,344 (GRCm39) L117F probably damaging Het
Myo1d C A 11: 80,565,758 (GRCm39) V356F probably damaging Het
Myo1d T A 11: 80,567,758 (GRCm39) I241F probably benign Het
Naalad2 A T 9: 18,297,230 (GRCm39) probably benign Het
Nacad T C 11: 6,552,853 (GRCm39) T113A probably benign Het
Nrap T A 19: 56,352,843 (GRCm39) probably benign Het
Or10b1 G A 10: 78,356,284 (GRCm39) V281M possibly damaging Het
Or2z2 T C 11: 58,345,936 (GRCm39) T280A possibly damaging Het
Or56b2 T A 7: 104,337,387 (GRCm39) I55N probably damaging Het
Or5ae1 T A 7: 84,565,626 (GRCm39) I213N possibly damaging Het
Or5w1 T C 2: 87,486,591 (GRCm39) I225V possibly damaging Het
Or6z3 T C 7: 6,463,763 (GRCm39) L85P probably damaging Het
Osbpl3 T C 6: 50,328,852 (GRCm39) D117G probably damaging Het
Parp9 C T 16: 35,773,981 (GRCm39) R318* probably null Het
Pcdhb18 A G 18: 37,623,374 (GRCm39) I235V probably benign Het
Pex16 T G 2: 92,209,366 (GRCm39) probably benign Het
Piezo2 T A 18: 63,248,034 (GRCm39) M489L probably benign Het
Pmepa1 C A 2: 173,069,628 (GRCm39) G271V probably damaging Het
Safb A G 17: 56,910,579 (GRCm39) E659G unknown Het
Scn9a T C 2: 66,332,010 (GRCm39) T1289A probably damaging Het
Secisbp2l T C 2: 125,617,596 (GRCm39) D27G possibly damaging Het
Serpina1f A G 12: 103,660,240 (GRCm39) V14A probably benign Het
Serpinb9b C A 13: 33,213,452 (GRCm39) T3N possibly damaging Het
Sfxn5 C T 6: 85,206,182 (GRCm39) M315I probably benign Het
Slc9b2 A G 3: 135,035,530 (GRCm39) D333G probably benign Het
Sostdc1 A G 12: 36,367,229 (GRCm39) N135S possibly damaging Het
Spg11 T G 2: 121,901,425 (GRCm39) D1505A probably damaging Het
Spmip8 A T 8: 96,047,883 (GRCm39) probably benign Het
Taar7a T C 10: 23,869,279 (GRCm39) N34S probably benign Het
Tcerg1l C A 7: 137,811,526 (GRCm39) R556L possibly damaging Het
Tcp11l1 T C 2: 104,518,763 (GRCm39) K311R probably benign Het
Trbv16 T G 6: 41,128,972 (GRCm39) F52C probably damaging Het
Ttn T A 2: 76,726,016 (GRCm39) R6073S unknown Het
Uba1y T C Y: 828,818 (GRCm39) I542T possibly damaging Het
Vmn1r214 T C 13: 23,219,082 (GRCm39) I192T probably benign Het
Vmn2r67 C T 7: 84,786,346 (GRCm39) C553Y probably damaging Het
Zdhhc17 G T 10: 110,784,121 (GRCm39) H452N possibly damaging Het
Other mutations in Ehd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ehd2 APN 7 15,697,392 (GRCm39) missense possibly damaging 0.89
IGL03117:Ehd2 APN 7 15,684,396 (GRCm39) missense possibly damaging 0.81
R0485:Ehd2 UTSW 7 15,686,001 (GRCm39) missense probably benign 0.07
R1858:Ehd2 UTSW 7 15,686,113 (GRCm39) missense probably benign 0.00
R2151:Ehd2 UTSW 7 15,686,128 (GRCm39) missense probably damaging 0.96
R2857:Ehd2 UTSW 7 15,698,054 (GRCm39) missense probably damaging 1.00
R2859:Ehd2 UTSW 7 15,698,054 (GRCm39) missense probably damaging 1.00
R5965:Ehd2 UTSW 7 15,685,999 (GRCm39) missense possibly damaging 0.94
R6175:Ehd2 UTSW 7 15,697,389 (GRCm39) nonsense probably null
R6562:Ehd2 UTSW 7 15,691,492 (GRCm39) missense probably benign 0.04
R6874:Ehd2 UTSW 7 15,684,363 (GRCm39) missense probably benign 0.23
R7400:Ehd2 UTSW 7 15,684,581 (GRCm39) missense possibly damaging 0.57
R7552:Ehd2 UTSW 7 15,684,431 (GRCm39) missense probably damaging 0.98
R7644:Ehd2 UTSW 7 15,691,474 (GRCm39) missense possibly damaging 0.60
R7792:Ehd2 UTSW 7 15,684,683 (GRCm39) missense probably benign 0.22
R8167:Ehd2 UTSW 7 15,697,917 (GRCm39) missense probably damaging 0.98
R8716:Ehd2 UTSW 7 15,698,106 (GRCm39) missense probably benign 0.00
R9123:Ehd2 UTSW 7 15,684,626 (GRCm39) missense probably damaging 0.96
R9469:Ehd2 UTSW 7 15,684,332 (GRCm39) missense probably damaging 1.00
R9500:Ehd2 UTSW 7 15,686,077 (GRCm39) missense possibly damaging 0.86
Z1088:Ehd2 UTSW 7 15,697,391 (GRCm39) missense possibly damaging 0.94
Z1177:Ehd2 UTSW 7 15,691,830 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCGTTTCACTAGGTCGTTGAG -3'
(R):5'- TTGCTCCAGGCTACGACTTC -3'

Sequencing Primer
(F):5'- CACTAGGTCGTTGAGCTTGC -3'
(R):5'- TGAACGCGTGGACCTCATCATC -3'
Posted On 2021-04-30