Incidental Mutation 'R8810:Acan'
ID672342
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8810 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79099704 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1408 (S1408P)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
AlphaFold Q61282
Predicted Effect probably damaging
Transcript: ENSMUST00000032835
AA Change: S1408P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: S1408P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T C 4: 155,905,712 V783A probably damaging Het
Akap8 T C 17: 32,306,530 N525S probably damaging Het
Aqp1 C T 6: 55,336,621 T44M probably damaging Het
Arap1 T C 7: 101,404,378 Y1305H probably damaging Het
Atg2a T G 19: 6,250,621 S743A probably benign Het
AW551984 G T 9: 39,600,011 L133I probably damaging Het
Bahcc1 C A 11: 120,273,761 P802T possibly damaging Het
Brd8 C A 18: 34,609,949 V288L probably benign Het
Carmil2 T C 8: 105,686,315 probably null Het
Catspere2 G A 1: 178,077,482 E153K possibly damaging Het
Ccdc162 C T 10: 41,666,741 R379Q probably benign Het
Cdh16 A G 8: 104,614,504 L116P probably damaging Het
Cenpj A T 14: 56,558,619 H260Q possibly damaging Het
Cenpq A G 17: 40,933,136 V17A possibly damaging Het
Cep350 T C 1: 155,928,116 K1074E probably damaging Het
Chil4 C A 3: 106,201,805 C394F probably damaging Het
Chst9 T C 18: 15,717,926 I28V probably benign Het
Clasp2 C A 9: 113,899,581 N873K probably damaging Het
Clec4b2 T A 6: 123,181,310 M45K probably benign Het
Cmya5 T A 13: 93,063,540 T3427S possibly damaging Het
Cnih4 A G 1: 181,162,212 Y130C probably damaging Het
Cpne9 T A 6: 113,304,545 M529K probably damaging Het
Ctsr T A 13: 61,161,825 Y190F probably damaging Het
Cyp2j13 G A 4: 96,056,916 H351Y probably benign Het
Dixdc1 T A 9: 50,701,965 Q230L probably damaging Het
Dpep1 A T 8: 123,200,025 I226F probably benign Het
Ehd2 A G 7: 15,957,678 V243A probably benign Het
Etnk2 T A 1: 133,378,494 Y353N probably benign Het
Fgg G T 3: 83,013,015 G367V probably damaging Het
Gm11639 A T 11: 104,914,895 N3076I unknown Het
Gm609 T C 16: 45,443,836 T120A probably benign Het
Grk5 T G 19: 61,089,994 D496E possibly damaging Het
Hc T C 2: 35,019,523 N915S probably benign Het
Iah1 G T 12: 21,317,387 Q31H probably benign Het
Insr T C 8: 3,169,714 D936G probably benign Het
Ints6 A C 14: 62,702,453 V596G probably benign Het
Ispd A T 12: 36,390,482 N130Y probably damaging Het
Kcnj16 A G 11: 111,024,851 D113G possibly damaging Het
Kdm4b A T 17: 56,399,771 I928F probably damaging Het
Lrrc41 C T 4: 116,075,291 probably benign Het
Lrrc8e G A 8: 4,235,070 V432I probably benign Het
Mamdc4 T C 2: 25,568,489 E336G probably benign Het
Maml2 C A 9: 13,621,622 Q711K Het
Map3k14 T C 11: 103,227,672 T563A possibly damaging Het
Mcu T A 10: 59,467,713 K101* probably null Het
Mettl22 T A 16: 8,485,928 V286E probably damaging Het
Mon2 A T 10: 123,009,611 N1396K possibly damaging Het
Mprip T C 11: 59,697,025 probably benign Het
Mrpl51 C T 6: 125,193,381 L117F probably damaging Het
Myo1d C A 11: 80,674,932 V356F probably damaging Het
Myo1d T A 11: 80,676,932 I241F probably benign Het
Nacad T C 11: 6,602,853 T113A probably benign Het
Nrap T A 19: 56,364,411 probably benign Het
Olfr1134 T C 2: 87,656,247 I225V possibly damaging Het
Olfr1336 T C 7: 6,460,764 L85P probably damaging Het
Olfr1358 G A 10: 78,520,450 V281M possibly damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr30 T C 11: 58,455,110 T280A possibly damaging Het
Olfr661 T A 7: 104,688,180 I55N probably damaging Het
Osbpl3 T C 6: 50,351,872 D117G probably damaging Het
Parp9 C T 16: 35,953,611 R318* probably null Het
Pcdhb18 A G 18: 37,490,321 I235V probably benign Het
Piezo2 T A 18: 63,114,963 M489L probably benign Het
Pmepa1 C A 2: 173,227,835 G271V probably damaging Het
Safb A G 17: 56,603,579 E659G unknown Het
Scn9a T C 2: 66,501,666 T1289A probably damaging Het
Secisbp2l T C 2: 125,775,676 D27G possibly damaging Het
Serpina1f A G 12: 103,693,981 V14A probably benign Het
Serpinb9b C A 13: 33,029,469 T3N possibly damaging Het
Sfxn5 C T 6: 85,229,200 M315I probably benign Het
Slc9b2 A G 3: 135,329,769 D333G probably benign Het
Sostdc1 A G 12: 36,317,230 N135S possibly damaging Het
Spg11 T G 2: 122,070,944 D1505A probably damaging Het
Taar7a T C 10: 23,993,381 N34S probably benign Het
Tcerg1l C A 7: 138,209,797 R556L possibly damaging Het
Tcp11l1 T C 2: 104,688,418 K311R probably benign Het
Trbv16 T G 6: 41,152,038 F52C probably damaging Het
Ttn T A 2: 76,895,672 R6073S unknown Het
Uba1y T C Y: 828,818 I542T possibly damaging Het
Vmn1r214 T C 13: 23,034,912 I192T probably benign Het
Vmn2r67 C T 7: 85,137,138 C553Y probably damaging Het
Zdhhc17 G T 10: 110,948,260 H452N possibly damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Disproportion UTSW 7 79092318 missense probably damaging 0.98
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
R8482:Acan UTSW 7 79096744 missense probably benign 0.02
R8511:Acan UTSW 7 79097935 missense possibly damaging 0.94
R8716:Acan UTSW 7 79112690 missense probably damaging 1.00
R8753:Acan UTSW 7 79098768 missense possibly damaging 0.83
R8898:Acan UTSW 7 79100353 missense possibly damaging 0.59
R8956:Acan UTSW 7 79100965 missense probably benign 0.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCAAGCATCTGGATCTC -3'
(R):5'- TGTAATGCCAGAAGACTCTCCAC -3'

Sequencing Primer
(F):5'- TCTCCTGATAGCAGTGGAGAAACATC -3'
(R):5'- GAAGACTCTCCACTGCCACTTATG -3'
Posted On2021-04-30