Mutagenetix > Incidental Mutation

Incidental Mutation 'R8810:Arap1'

672345

Institutional Source

Beutler Lab

Gene Symbol

Arap1

Ensembl Gene

ENSMUSG00000032812

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1

Synonyms

Centd2, 2410002L19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8810 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101348067-101412586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101404378 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1305 (Y1305H)

Ref Sequence

ENSEMBL: ENSMUSP00000081958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000098243] [ENSMUST00000107010]

AlphaFold

Q4LDD4

Predicted Effect

probably damaging
Transcript: ENSMUST00000084895
AA Change: Y1057H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812
AA Change: Y1057H

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
PH	82	175	2.62e-17	SMART
PH	195	285	3.6e-6	SMART
ArfGap	289	415	2.4e-22	SMART
PH	498	606	1.23e-13	SMART
PH	616	710	1.08e0	SMART
RhoGAP	722	904	1.35e-63	SMART
Pfam:RA	926	1015	1.5e-10	PFAM
PH	1029	1141	8.58e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000084896
AA Change: Y1305H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: Y1305H

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	6.6e-13	PFAM
PH	1277	1400	8e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098243
AA Change: Y591H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095844
Gene: ENSMUSG00000032812
AA Change: Y591H

Domain	Start	End	E-Value	Type
PH	32	140	1.23e-13	SMART
PH	150	244	1.08e0	SMART
RhoGAP	256	438	1.35e-63	SMART
Pfam:RA	460	549	1.2e-11	PFAM
PH	563	675	8.58e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107010
AA Change: Y1305H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: Y1305H

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	1.9e-10	PFAM
PH	1277	1389	8.58e-13	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,704	S1408P	probably damaging	Het
Acap3	T	C	4: 155,905,712	V783A	probably damaging	Het
Akap8	T	C	17: 32,306,530	N525S	probably damaging	Het
Aqp1	C	T	6: 55,336,621	T44M	probably damaging	Het
Atg2a	T	G	19: 6,250,621	S743A	probably benign	Het
AW551984	G	T	9: 39,600,011	L133I	probably damaging	Het
Bahcc1	C	A	11: 120,273,761	P802T	possibly damaging	Het
Brd8	C	A	18: 34,609,949	V288L	probably benign	Het
Carmil2	T	C	8: 105,686,315		probably null	Het
Catspere2	G	A	1: 178,077,482	E153K	possibly damaging	Het
Ccdc162	C	T	10: 41,666,741	R379Q	probably benign	Het
Cdh16	A	G	8: 104,614,504	L116P	probably damaging	Het
Cenpj	A	T	14: 56,558,619	H260Q	possibly damaging	Het
Cenpq	A	G	17: 40,933,136	V17A	possibly damaging	Het
Cep350	T	C	1: 155,928,116	K1074E	probably damaging	Het
Chil4	C	A	3: 106,201,805	C394F	probably damaging	Het
Chst9	T	C	18: 15,717,926	I28V	probably benign	Het
Clasp2	C	A	9: 113,899,581	N873K	probably damaging	Het
Clec4b2	T	A	6: 123,181,310	M45K	probably benign	Het
Cmya5	T	A	13: 93,063,540	T3427S	possibly damaging	Het
Cnih4	A	G	1: 181,162,212	Y130C	probably damaging	Het
Cpne9	T	A	6: 113,304,545	M529K	probably damaging	Het
Ctsr	T	A	13: 61,161,825	Y190F	probably damaging	Het
Cyp2j13	G	A	4: 96,056,916	H351Y	probably benign	Het
Dixdc1	T	A	9: 50,701,965	Q230L	probably damaging	Het
Dpep1	A	T	8: 123,200,025	I226F	probably benign	Het
Ehd2	A	G	7: 15,957,678	V243A	probably benign	Het
Etnk2	T	A	1: 133,378,494	Y353N	probably benign	Het
Fgg	G	T	3: 83,013,015	G367V	probably damaging	Het
Gm11639	A	T	11: 104,914,895	N3076I	unknown	Het
Gm609	T	C	16: 45,443,836	T120A	probably benign	Het
Gm9772	T	C	17: 22,006,329	*61Q	probably null	Het
Grk5	T	G	19: 61,089,994	D496E	possibly damaging	Het
Hc	T	C	2: 35,019,523	N915S	probably benign	Het
Iah1	G	T	12: 21,317,387	Q31H	probably benign	Het
Insr	T	C	8: 3,169,714	D936G	probably benign	Het
Ints6	A	C	14: 62,702,453	V596G	probably benign	Het
Ispd	A	T	12: 36,390,482	N130Y	probably damaging	Het
Kcnj16	A	G	11: 111,024,851	D113G	possibly damaging	Het
Kdm4b	A	T	17: 56,399,771	I928F	probably damaging	Het
Lrrc41	C	T	4: 116,075,291		probably benign	Het
Lrrc8e	G	A	8: 4,235,070	V432I	probably benign	Het
Mamdc4	T	C	2: 25,568,489	E336G	probably benign	Het
Maml2	C	A	9: 13,621,622	Q711K		Het
Map3k14	T	C	11: 103,227,672	T563A	possibly damaging	Het
Mcu	T	A	10: 59,467,713	K101*	probably null	Het
Mettl22	T	A	16: 8,485,928	V286E	probably damaging	Het
Mon2	A	T	10: 123,009,611	N1396K	possibly damaging	Het
Mprip	T	C	11: 59,697,025		probably benign	Het
Mrpl51	C	T	6: 125,193,381	L117F	probably damaging	Het
Myo1d	C	A	11: 80,674,932	V356F	probably damaging	Het
Myo1d	T	A	11: 80,676,932	I241F	probably benign	Het
Naalad2	A	T	9: 18,385,934		probably benign	Het
Nacad	T	C	11: 6,602,853	T113A	probably benign	Het
Nrap	T	A	19: 56,364,411		probably benign	Het
Olfr1134	T	C	2: 87,656,247	I225V	possibly damaging	Het
Olfr1336	T	C	7: 6,460,764	L85P	probably damaging	Het
Olfr1358	G	A	10: 78,520,450	V281M	possibly damaging	Het
Olfr290	T	A	7: 84,916,418	I213N	possibly damaging	Het
Olfr30	T	C	11: 58,455,110	T280A	possibly damaging	Het
Olfr661	T	A	7: 104,688,180	I55N	probably damaging	Het
Osbpl3	T	C	6: 50,351,872	D117G	probably damaging	Het
Parp9	C	T	16: 35,953,611	R318*	probably null	Het
Pcdhb18	A	G	18: 37,490,321	I235V	probably benign	Het
Pex16	T	G	2: 92,379,021		probably benign	Het
Piezo2	T	A	18: 63,114,963	M489L	probably benign	Het
Pmepa1	C	A	2: 173,227,835	G271V	probably damaging	Het
Safb	A	G	17: 56,603,579	E659G	unknown	Het
Scn9a	T	C	2: 66,501,666	T1289A	probably damaging	Het
Secisbp2l	T	C	2: 125,775,676	D27G	possibly damaging	Het
Serpina1f	A	G	12: 103,693,981	V14A	probably benign	Het
Serpinb9b	C	A	13: 33,029,469	T3N	possibly damaging	Het
Sfxn5	C	T	6: 85,229,200	M315I	probably benign	Het
Slc9b2	A	G	3: 135,329,769	D333G	probably benign	Het
Sostdc1	A	G	12: 36,317,230	N135S	possibly damaging	Het
Spg11	T	G	2: 122,070,944	D1505A	probably damaging	Het
Taar7a	T	C	10: 23,993,381	N34S	probably benign	Het
Tcerg1l	C	A	7: 138,209,797	R556L	possibly damaging	Het
Tcp11l1	T	C	2: 104,688,418	K311R	probably benign	Het
Tepp	A	T	8: 95,321,255		probably benign	Het
Trbv16	T	G	6: 41,152,038	F52C	probably damaging	Het
Ttn	T	A	2: 76,895,672	R6073S	unknown	Het
Uba1y	T	C	Y: 828,818	I542T	possibly damaging	Het
Vmn1r214	T	C	13: 23,034,912	I192T	probably benign	Het
Vmn2r67	C	T	7: 85,137,138	C553Y	probably damaging	Het
Zdhhc17	G	T	10: 110,948,260	H452N	possibly damaging	Het

Other mutations in Arap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Arap1	APN	7	101388049	missense	probably damaging	0.96
IGL01311:Arap1	APN	7	101388136	nonsense	probably null
IGL01349:Arap1	APN	7	101387152	missense	possibly damaging	0.84
IGL01521:Arap1	APN	7	101400605	critical splice donor site	probably null
IGL01869:Arap1	APN	7	101400283	missense	probably damaging	1.00
IGL02156:Arap1	APN	7	101388730	unclassified	probably benign
IGL02320:Arap1	APN	7	101385029	missense	probably benign
IGL02478:Arap1	APN	7	101400125	splice site	probably null
R0133:Arap1	UTSW	7	101386229	missense	probably damaging	0.98
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0412:Arap1	UTSW	7	101390222	missense	probably damaging	0.98
R0616:Arap1	UTSW	7	101401650	missense	possibly damaging	0.64
R0838:Arap1	UTSW	7	101400412	missense	probably damaging	1.00
R0962:Arap1	UTSW	7	101384914	missense	possibly damaging	0.56
R1186:Arap1	UTSW	7	101404269	splice site	probably benign
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1724:Arap1	UTSW	7	101400526	missense	possibly damaging	0.91
R1793:Arap1	UTSW	7	101388622	missense	probably benign
R1959:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R1960:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R2020:Arap1	UTSW	7	101401518	missense	probably benign	0.00
R2128:Arap1	UTSW	7	101409320	missense	probably damaging	1.00
R3737:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R3851:Arap1	UTSW	7	101390165	nonsense	probably null
R4034:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R4386:Arap1	UTSW	7	101385571	missense	probably benign
R4435:Arap1	UTSW	7	101390254	missense	possibly damaging	0.74
R4779:Arap1	UTSW	7	101404367	missense	probably damaging	1.00
R4786:Arap1	UTSW	7	101385005	missense	possibly damaging	0.94
R4850:Arap1	UTSW	7	101398791	missense	probably damaging	1.00
R4942:Arap1	UTSW	7	101401802	missense	possibly damaging	0.95
R5253:Arap1	UTSW	7	101388644	missense	probably benign	0.00
R5342:Arap1	UTSW	7	101404960	missense	probably benign	0.00
R5367:Arap1	UTSW	7	101409130	missense	probably damaging	0.99
R5397:Arap1	UTSW	7	101384912	missense	possibly damaging	0.95
R5968:Arap1	UTSW	7	101394738	missense	probably damaging	1.00
R6052:Arap1	UTSW	7	101404033	missense	probably damaging	1.00
R6574:Arap1	UTSW	7	101404001	missense	probably damaging	1.00
R6645:Arap1	UTSW	7	101408111	missense	possibly damaging	0.57
R7060:Arap1	UTSW	7	101409357	splice site	probably null
R7191:Arap1	UTSW	7	101384992	missense	probably benign	0.31
R7323:Arap1	UTSW	7	101400211	missense	probably damaging	1.00
R7349:Arap1	UTSW	7	101390228	missense	possibly damaging	0.95
R7516:Arap1	UTSW	7	101409331	missense	probably benign	0.00
R7922:Arap1	UTSW	7	101404414	nonsense	probably null
R8034:Arap1	UTSW	7	101394773	missense	probably damaging	1.00
R8293:Arap1	UTSW	7	101400934	missense	probably benign
R8493:Arap1	UTSW	7	101386518	nonsense	probably null
R8811:Arap1	UTSW	7	101387196	missense	probably damaging	1.00
R8928:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8930:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8931:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8941:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R9014:Arap1	UTSW	7	101404333	missense	probably damaging	1.00
R9144:Arap1	UTSW	7	101398395	missense	probably damaging	1.00
R9164:Arap1	UTSW	7	101391883	nonsense	probably null
R9215:Arap1	UTSW	7	101400007	missense	probably benign	0.23
R9340:Arap1	UTSW	7	101388175	missense	probably damaging	1.00
R9519:Arap1	UTSW	7	101394739	start gained	probably benign
R9790:Arap1	UTSW	7	101388169	missense	probably benign	0.00
R9791:Arap1	UTSW	7	101388169	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTCCATCTACAAGCAGGGTG -3'
(R):5'- TCATCAGTCATGGTGCTGCC -3'

Sequencing Primer
(F):5'- CATCTACAAGCAGGGTGGGAGC -3'
(R):5'- AGTCATGGTGCTGCCGAGAC -3'

Posted On

2021-04-30