Incidental Mutation 'K3955:Ces3a'
ID67235
Institutional Source Beutler Lab
Gene Symbol Ces3a
Ensembl Gene ENSMUSG00000069922
Gene Namecarboxylesterase 3A
SynonymsEs31, Es-male carboxylesterase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #K3955 (G3) of strain 706
Quality Score182
Status Validated
Chromosome8
Chromosomal Location105048601-105058413 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 105050627 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093222] [ENSMUST00000093223]
Predicted Effect probably benign
Transcript: ENSMUST00000093222
SMART Domains Protein: ENSMUSP00000090910
Gene: ENSMUSG00000069922

DomainStartEndE-ValueType
Pfam:COesterase 16 547 1.1e-163 PFAM
Pfam:Abhydrolase_3 147 305 5.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093223
SMART Domains Protein: ENSMUSP00000090911
Gene: ENSMUSG00000069922

DomainStartEndE-ValueType
Pfam:COesterase 16 320 1.4e-111 PFAM
Pfam:Abhydrolase_3 147 319 4.8e-14 PFAM
Pfam:COesterase 312 500 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213054
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 G A 1: 89,887,604 R738H probably damaging Het
Arhgap28 T C 17: 68,004,006 E2G probably damaging Het
Atad2b C A 12: 4,954,536 probably benign Het
Atmin T A 8: 116,957,036 C478* probably null Het
Calr T C 8: 84,846,273 Y57C probably damaging Het
Cdh13 G A 8: 118,675,104 V82M probably damaging Het
Dmbt1 T C 7: 131,119,564 Y1854H probably damaging Het
Dnah1 T A 14: 31,266,459 M3429L probably benign Het
Dscam A G 16: 96,673,687 F1225S probably benign Het
E030025P04Rik G A 11: 109,143,952 P37S unknown Het
Eral1 A T 11: 78,076,021 D189E probably damaging Het
Fbxw14 G T 9: 109,276,245 P284Q possibly damaging Het
Fcrl6 A G 1: 172,597,684 V260A probably benign Het
Fezf2 A T 14: 12,345,097 F30Y probably damaging Het
Gjb4 A T 4: 127,351,500 V216D probably benign Het
Gm13023 T C 4: 143,795,140 I442T possibly damaging Het
Gm9758 G A 5: 14,913,508 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gmps A C 3: 64,001,533 R485S probably damaging Het
Gtdc1 C T 2: 44,752,221 probably null Het
H2-Ob C T 17: 34,241,184 R19C probably damaging Het
Lars2 T C 9: 123,377,777 V103A probably damaging Het
Ndnf G A 6: 65,701,429 probably benign Het
Nectin1 A G 9: 43,792,078 Y211C probably damaging Het
Notch4 C T 17: 34,568,462 T332I probably damaging Het
Olfr272 A G 4: 52,911,081 F238L probably damaging Het
Olfr945 A C 9: 39,258,630 L14W probably damaging Het
Olfr968 A G 9: 39,772,173 I209T probably benign Het
Paf1 T C 7: 28,396,925 probably null Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Prkcq T C 2: 11,246,793 probably benign Het
Proser3 G T 7: 30,543,499 P218T probably damaging Het
Rccd1 G A 7: 80,320,671 S66F probably benign Het
Recql G T 6: 142,378,206 S54* probably null Het
Samd15 G T 12: 87,200,760 G73V probably benign Het
Siglec1 T C 2: 131,081,439 N462S probably benign Het
Skiv2l2 A C 13: 112,910,979 Y277* probably null Het
Syne2 G T 12: 75,930,665 A1296S probably damaging Het
Tlk1 T C 2: 70,721,701 E542G possibly damaging Het
Tnks1bp1 C T 2: 85,062,411 T232I probably benign Het
Tnrc6c T A 11: 117,760,738 Y1696N probably damaging Het
Uggt1 A G 1: 36,162,353 I1102T probably benign Het
Vmn1r84 C T 7: 12,361,957 V270M probably damaging Het
Wasf1 C T 10: 40,936,195 P327S unknown Het
Other mutations in Ces3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Ces3a APN 8 105050570 missense probably damaging 1.00
IGL01557:Ces3a APN 8 105057751 missense probably damaging 1.00
IGL02092:Ces3a APN 8 105050330 splice site probably benign
IGL02140:Ces3a APN 8 105055631 missense probably benign 0.07
R0724:Ces3a UTSW 8 105050195 missense possibly damaging 0.73
R1066:Ces3a UTSW 8 105055656 missense probably benign 0.01
R1223:Ces3a UTSW 8 105058029 missense probably benign 0.00
R1224:Ces3a UTSW 8 105051509 missense probably damaging 1.00
R1340:Ces3a UTSW 8 105057913 missense probably damaging 1.00
R1513:Ces3a UTSW 8 105050277 missense probably damaging 1.00
R1740:Ces3a UTSW 8 105048685 missense probably damaging 1.00
R2192:Ces3a UTSW 8 105055580 missense probably benign
R3407:Ces3a UTSW 8 105050567 missense probably damaging 1.00
R4002:Ces3a UTSW 8 105057461 missense probably damaging 1.00
R4668:Ces3a UTSW 8 105053423 missense probably damaging 1.00
R5045:Ces3a UTSW 8 105050616 critical splice donor site probably null
R5331:Ces3a UTSW 8 105057556 missense probably damaging 1.00
R5450:Ces3a UTSW 8 105057918 missense possibly damaging 0.83
R5535:Ces3a UTSW 8 105051564 missense probably benign 0.34
R5640:Ces3a UTSW 8 105051745 missense probably benign 0.42
R5881:Ces3a UTSW 8 105050566 missense probably damaging 1.00
R6795:Ces3a UTSW 8 105050596 missense possibly damaging 0.94
R7112:Ces3a UTSW 8 105057962 missense probably damaging 1.00
R7323:Ces3a UTSW 8 105055607 missense possibly damaging 0.54
R7419:Ces3a UTSW 8 105056424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCCACTGATTCAAAGCCATTTC -3'
(R):5'- GAGCCAACACCCTTTGCTCAAATTC -3'

Sequencing Primer
(F):5'- AAGCCATTTCTCTAGGTCATGGTATG -3'
(R):5'- ctctctctctctctctctctcc -3'
Posted On2013-09-03