Incidental Mutation 'R8810:Cdh16'
ID 672350
Institutional Source Beutler Lab
Gene Symbol Cdh16
Ensembl Gene ENSMUSG00000031881
Gene Name cadherin 16
Synonyms KSP-cadherin
MMRRC Submission 068725-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 105328547-105351028 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105341136 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 116 (L116P)
Ref Sequence ENSEMBL: ENSMUSP00000148602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163783] [ENSMUST00000211849] [ENSMUST00000211903] [ENSMUST00000212045] [ENSMUST00000212324] [ENSMUST00000212420] [ENSMUST00000212447] [ENSMUST00000212882] [ENSMUST00000213033]
AlphaFold O88338
Predicted Effect probably benign
Transcript: ENSMUST00000163783
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211849
Predicted Effect probably benign
Transcript: ENSMUST00000211889
Predicted Effect probably benign
Transcript: ENSMUST00000211903
Predicted Effect probably damaging
Transcript: ENSMUST00000212045
AA Change: L116P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000212318
Predicted Effect probably benign
Transcript: ENSMUST00000212324
Predicted Effect probably benign
Transcript: ENSMUST00000212420
Predicted Effect probably benign
Transcript: ENSMUST00000212447
Predicted Effect probably benign
Transcript: ENSMUST00000212882
Predicted Effect probably benign
Transcript: ENSMUST00000213033
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 78,749,452 (GRCm39) S1408P probably damaging Het
Acap3 T C 4: 155,990,169 (GRCm39) V783A probably damaging Het
Akap8 T C 17: 32,525,504 (GRCm39) N525S probably damaging Het
Aqp1 C T 6: 55,313,606 (GRCm39) T44M probably damaging Het
Arap1 T C 7: 101,053,585 (GRCm39) Y1305H probably damaging Het
Atg2a T G 19: 6,300,651 (GRCm39) S743A probably benign Het
AW551984 G T 9: 39,511,307 (GRCm39) L133I probably damaging Het
Bahcc1 C A 11: 120,164,587 (GRCm39) P802T possibly damaging Het
Brd8 C A 18: 34,743,002 (GRCm39) V288L probably benign Het
Carmil2 T C 8: 106,412,947 (GRCm39) probably null Het
Catspere2 G A 1: 177,905,048 (GRCm39) E153K possibly damaging Het
Ccdc162 C T 10: 41,542,737 (GRCm39) R379Q probably benign Het
Cd200l1 T C 16: 45,264,199 (GRCm39) T120A probably benign Het
Cenpj A T 14: 56,796,076 (GRCm39) H260Q possibly damaging Het
Cenpq A G 17: 41,244,027 (GRCm39) V17A possibly damaging Het
Cep350 T C 1: 155,803,862 (GRCm39) K1074E probably damaging Het
Chil4 C A 3: 106,109,121 (GRCm39) C394F probably damaging Het
Chst9 T C 18: 15,850,983 (GRCm39) I28V probably benign Het
Clasp2 C A 9: 113,728,649 (GRCm39) N873K probably damaging Het
Clec4b2 T A 6: 123,158,269 (GRCm39) M45K probably benign Het
Cmya5 T A 13: 93,200,048 (GRCm39) T3427S possibly damaging Het
Cnih4 A G 1: 180,989,777 (GRCm39) Y130C probably damaging Het
Cpne9 T A 6: 113,281,506 (GRCm39) M529K probably damaging Het
Crppa A T 12: 36,440,481 (GRCm39) N130Y probably damaging Het
Ctsr T A 13: 61,309,639 (GRCm39) Y190F probably damaging Het
Cyp2j13 G A 4: 95,945,153 (GRCm39) H351Y probably benign Het
Dixdc1 T A 9: 50,613,265 (GRCm39) Q230L probably damaging Het
Dpep1 A T 8: 123,926,764 (GRCm39) I226F probably benign Het
Efcab3 A T 11: 104,805,721 (GRCm39) N3076I unknown Het
Ehd2 A G 7: 15,691,603 (GRCm39) V243A probably benign Het
Etnk2 T A 1: 133,306,232 (GRCm39) Y353N probably benign Het
Fgg G T 3: 82,920,322 (GRCm39) G367V probably damaging Het
Gm9772 T C 17: 22,225,310 (GRCm39) *61Q probably null Het
Grk5 T G 19: 61,078,432 (GRCm39) D496E possibly damaging Het
Hc T C 2: 34,909,535 (GRCm39) N915S probably benign Het
Iah1 G T 12: 21,367,388 (GRCm39) Q31H probably benign Het
Insr T C 8: 3,219,714 (GRCm39) D936G probably benign Het
Ints6 A C 14: 62,939,902 (GRCm39) V596G probably benign Het
Kcnj16 A G 11: 110,915,677 (GRCm39) D113G possibly damaging Het
Kdm4b A T 17: 56,706,771 (GRCm39) I928F probably damaging Het
Lrrc41 C T 4: 115,932,488 (GRCm39) probably benign Het
Lrrc8e G A 8: 4,285,070 (GRCm39) V432I probably benign Het
Mamdc4 T C 2: 25,458,501 (GRCm39) E336G probably benign Het
Maml2 C A 9: 13,532,918 (GRCm39) Q711K Het
Map3k14 T C 11: 103,118,498 (GRCm39) T563A possibly damaging Het
Mcu T A 10: 59,303,535 (GRCm39) K101* probably null Het
Mettl22 T A 16: 8,303,792 (GRCm39) V286E probably damaging Het
Mon2 A T 10: 122,845,516 (GRCm39) N1396K possibly damaging Het
Mprip T C 11: 59,587,851 (GRCm39) probably benign Het
Mrpl51 C T 6: 125,170,344 (GRCm39) L117F probably damaging Het
Myo1d C A 11: 80,565,758 (GRCm39) V356F probably damaging Het
Myo1d T A 11: 80,567,758 (GRCm39) I241F probably benign Het
Naalad2 A T 9: 18,297,230 (GRCm39) probably benign Het
Nacad T C 11: 6,552,853 (GRCm39) T113A probably benign Het
Nrap T A 19: 56,352,843 (GRCm39) probably benign Het
Or10b1 G A 10: 78,356,284 (GRCm39) V281M possibly damaging Het
Or2z2 T C 11: 58,345,936 (GRCm39) T280A possibly damaging Het
Or56b2 T A 7: 104,337,387 (GRCm39) I55N probably damaging Het
Or5ae1 T A 7: 84,565,626 (GRCm39) I213N possibly damaging Het
Or5w1 T C 2: 87,486,591 (GRCm39) I225V possibly damaging Het
Or6z3 T C 7: 6,463,763 (GRCm39) L85P probably damaging Het
Osbpl3 T C 6: 50,328,852 (GRCm39) D117G probably damaging Het
Parp9 C T 16: 35,773,981 (GRCm39) R318* probably null Het
Pcdhb18 A G 18: 37,623,374 (GRCm39) I235V probably benign Het
Pex16 T G 2: 92,209,366 (GRCm39) probably benign Het
Piezo2 T A 18: 63,248,034 (GRCm39) M489L probably benign Het
Pmepa1 C A 2: 173,069,628 (GRCm39) G271V probably damaging Het
Safb A G 17: 56,910,579 (GRCm39) E659G unknown Het
Scn9a T C 2: 66,332,010 (GRCm39) T1289A probably damaging Het
Secisbp2l T C 2: 125,617,596 (GRCm39) D27G possibly damaging Het
Serpina1f A G 12: 103,660,240 (GRCm39) V14A probably benign Het
Serpinb9b C A 13: 33,213,452 (GRCm39) T3N possibly damaging Het
Sfxn5 C T 6: 85,206,182 (GRCm39) M315I probably benign Het
Slc9b2 A G 3: 135,035,530 (GRCm39) D333G probably benign Het
Sostdc1 A G 12: 36,367,229 (GRCm39) N135S possibly damaging Het
Spg11 T G 2: 121,901,425 (GRCm39) D1505A probably damaging Het
Spmip8 A T 8: 96,047,883 (GRCm39) probably benign Het
Taar7a T C 10: 23,869,279 (GRCm39) N34S probably benign Het
Tcerg1l C A 7: 137,811,526 (GRCm39) R556L possibly damaging Het
Tcp11l1 T C 2: 104,518,763 (GRCm39) K311R probably benign Het
Trbv16 T G 6: 41,128,972 (GRCm39) F52C probably damaging Het
Ttn T A 2: 76,726,016 (GRCm39) R6073S unknown Het
Uba1y T C Y: 828,818 (GRCm39) I542T possibly damaging Het
Vmn1r214 T C 13: 23,219,082 (GRCm39) I192T probably benign Het
Vmn2r67 C T 7: 84,786,346 (GRCm39) C553Y probably damaging Het
Zdhhc17 G T 10: 110,784,121 (GRCm39) H452N possibly damaging Het
Other mutations in Cdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cdh16 APN 8 105,350,045 (GRCm39) missense probably benign 0.00
IGL01406:Cdh16 APN 8 105,345,044 (GRCm39) missense possibly damaging 0.93
IGL01477:Cdh16 APN 8 105,345,140 (GRCm39) missense probably damaging 0.97
IGL01478:Cdh16 APN 8 105,341,120 (GRCm39) splice site probably benign
IGL01783:Cdh16 APN 8 105,344,488 (GRCm39) missense probably damaging 1.00
IGL01951:Cdh16 APN 8 105,344,323 (GRCm39) missense probably damaging 0.99
IGL02390:Cdh16 APN 8 105,348,606 (GRCm39) missense probably damaging 1.00
IGL02646:Cdh16 APN 8 105,348,737 (GRCm39) critical splice acceptor site probably null
IGL02938:Cdh16 APN 8 105,343,561 (GRCm39) intron probably benign
IGL02961:Cdh16 APN 8 105,341,837 (GRCm39) missense probably damaging 1.00
IGL03378:Cdh16 APN 8 105,345,917 (GRCm39) missense probably benign 0.09
PIT1430001:Cdh16 UTSW 8 105,344,271 (GRCm39) missense probably benign 0.05
R0016:Cdh16 UTSW 8 105,344,264 (GRCm39) missense probably benign 0.22
R1233:Cdh16 UTSW 8 105,345,114 (GRCm39) missense possibly damaging 0.89
R1470:Cdh16 UTSW 8 105,345,003 (GRCm39) missense probably benign 0.04
R1470:Cdh16 UTSW 8 105,345,003 (GRCm39) missense probably benign 0.04
R1490:Cdh16 UTSW 8 105,348,702 (GRCm39) missense probably damaging 1.00
R1752:Cdh16 UTSW 8 105,346,505 (GRCm39) critical splice donor site probably null
R1892:Cdh16 UTSW 8 105,344,631 (GRCm39) missense possibly damaging 0.69
R1913:Cdh16 UTSW 8 105,343,100 (GRCm39) missense probably benign 0.11
R1933:Cdh16 UTSW 8 105,344,595 (GRCm39) missense possibly damaging 0.71
R1934:Cdh16 UTSW 8 105,344,595 (GRCm39) missense possibly damaging 0.71
R2029:Cdh16 UTSW 8 105,344,434 (GRCm39) missense probably damaging 1.00
R2057:Cdh16 UTSW 8 105,348,597 (GRCm39) nonsense probably null
R2337:Cdh16 UTSW 8 105,348,902 (GRCm39) missense probably benign 0.09
R3848:Cdh16 UTSW 8 105,344,473 (GRCm39) missense possibly damaging 0.64
R3850:Cdh16 UTSW 8 105,344,473 (GRCm39) missense possibly damaging 0.64
R3892:Cdh16 UTSW 8 105,342,959 (GRCm39) missense probably damaging 1.00
R4167:Cdh16 UTSW 8 105,344,362 (GRCm39) missense probably benign 0.02
R4577:Cdh16 UTSW 8 105,345,191 (GRCm39) missense probably damaging 1.00
R4657:Cdh16 UTSW 8 105,341,858 (GRCm39) splice site probably null
R4726:Cdh16 UTSW 8 105,342,664 (GRCm39) missense probably damaging 0.97
R4843:Cdh16 UTSW 8 105,348,172 (GRCm39) missense probably damaging 1.00
R4878:Cdh16 UTSW 8 105,344,696 (GRCm39) missense probably damaging 1.00
R5013:Cdh16 UTSW 8 105,343,660 (GRCm39) missense probably damaging 1.00
R5642:Cdh16 UTSW 8 105,344,677 (GRCm39) missense probably damaging 0.98
R6134:Cdh16 UTSW 8 105,342,697 (GRCm39) missense probably benign 0.15
R6311:Cdh16 UTSW 8 105,341,065 (GRCm39) missense probably benign 0.40
R6352:Cdh16 UTSW 8 105,343,624 (GRCm39) missense probably damaging 0.99
R6382:Cdh16 UTSW 8 105,348,175 (GRCm39) missense possibly damaging 0.78
R6713:Cdh16 UTSW 8 105,346,617 (GRCm39) nonsense probably null
R6732:Cdh16 UTSW 8 105,345,165 (GRCm39) missense probably benign 0.28
R6755:Cdh16 UTSW 8 105,345,880 (GRCm39) missense probably damaging 1.00
R6913:Cdh16 UTSW 8 105,348,896 (GRCm39) missense probably benign 0.00
R7037:Cdh16 UTSW 8 105,344,267 (GRCm39) nonsense probably null
R7202:Cdh16 UTSW 8 105,340,780 (GRCm39) missense unknown
R7413:Cdh16 UTSW 8 105,346,572 (GRCm39) missense probably benign 0.00
R7460:Cdh16 UTSW 8 105,348,923 (GRCm39) missense possibly damaging 0.88
R8017:Cdh16 UTSW 8 105,342,899 (GRCm39) missense probably damaging 1.00
R8187:Cdh16 UTSW 8 105,344,870 (GRCm39) missense probably damaging 1.00
R8261:Cdh16 UTSW 8 105,341,811 (GRCm39) nonsense probably null
R8278:Cdh16 UTSW 8 105,345,107 (GRCm39) missense probably benign 0.39
R8421:Cdh16 UTSW 8 105,348,602 (GRCm39) missense probably benign 0.00
R8491:Cdh16 UTSW 8 105,343,681 (GRCm39) missense probably damaging 1.00
R8725:Cdh16 UTSW 8 105,344,874 (GRCm39) missense probably benign 0.00
R9246:Cdh16 UTSW 8 105,344,602 (GRCm39) missense probably benign
R9267:Cdh16 UTSW 8 105,341,834 (GRCm39) missense probably damaging 1.00
R9661:Cdh16 UTSW 8 105,345,612 (GRCm39) missense probably benign 0.41
R9689:Cdh16 UTSW 8 105,341,108 (GRCm39) missense probably benign
RF005:Cdh16 UTSW 8 105,343,684 (GRCm39) missense probably damaging 1.00
RF024:Cdh16 UTSW 8 105,343,684 (GRCm39) missense probably damaging 1.00
X0067:Cdh16 UTSW 8 105,346,649 (GRCm39) missense probably damaging 1.00
Z1176:Cdh16 UTSW 8 105,341,817 (GRCm39) missense probably damaging 1.00
Z1177:Cdh16 UTSW 8 105,350,072 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGTGAAGGGCTTTTACTCTG -3'
(R):5'- ACTTGGGAGGCTGGGATATC -3'

Sequencing Primer
(F):5'- CCCAGTGCATCTTGGGTACTG -3'
(R):5'- ATATCCTTTGATCTCGGTAAGGTC -3'
Posted On 2021-04-30