Incidental Mutation 'R8810:Myo1d'
ID 672366
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Name myosin ID
Synonyms 9930104H07Rik, D11Ertd9e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 80482126-80780025 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 80674932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 356 (V356F)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
AlphaFold Q5SYD0
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: V356F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: V356F

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070997
AA Change: V356F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: V356F

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,704 S1408P probably damaging Het
Acap3 T C 4: 155,905,712 V783A probably damaging Het
Akap8 T C 17: 32,306,530 N525S probably damaging Het
Aqp1 C T 6: 55,336,621 T44M probably damaging Het
Arap1 T C 7: 101,404,378 Y1305H probably damaging Het
Atg2a T G 19: 6,250,621 S743A probably benign Het
AW551984 G T 9: 39,600,011 L133I probably damaging Het
Bahcc1 C A 11: 120,273,761 P802T possibly damaging Het
Brd8 C A 18: 34,609,949 V288L probably benign Het
Carmil2 T C 8: 105,686,315 probably null Het
Catspere2 G A 1: 178,077,482 E153K possibly damaging Het
Ccdc162 C T 10: 41,666,741 R379Q probably benign Het
Cdh16 A G 8: 104,614,504 L116P probably damaging Het
Cenpj A T 14: 56,558,619 H260Q possibly damaging Het
Cenpq A G 17: 40,933,136 V17A possibly damaging Het
Cep350 T C 1: 155,928,116 K1074E probably damaging Het
Chil4 C A 3: 106,201,805 C394F probably damaging Het
Chst9 T C 18: 15,717,926 I28V probably benign Het
Clasp2 C A 9: 113,899,581 N873K probably damaging Het
Clec4b2 T A 6: 123,181,310 M45K probably benign Het
Cmya5 T A 13: 93,063,540 T3427S possibly damaging Het
Cnih4 A G 1: 181,162,212 Y130C probably damaging Het
Cpne9 T A 6: 113,304,545 M529K probably damaging Het
Ctsr T A 13: 61,161,825 Y190F probably damaging Het
Cyp2j13 G A 4: 96,056,916 H351Y probably benign Het
Dixdc1 T A 9: 50,701,965 Q230L probably damaging Het
Dpep1 A T 8: 123,200,025 I226F probably benign Het
Ehd2 A G 7: 15,957,678 V243A probably benign Het
Etnk2 T A 1: 133,378,494 Y353N probably benign Het
Fgg G T 3: 83,013,015 G367V probably damaging Het
Gm11639 A T 11: 104,914,895 N3076I unknown Het
Gm609 T C 16: 45,443,836 T120A probably benign Het
Gm9772 T C 17: 22,006,329 *61Q probably null Het
Grk5 T G 19: 61,089,994 D496E possibly damaging Het
Hc T C 2: 35,019,523 N915S probably benign Het
Iah1 G T 12: 21,317,387 Q31H probably benign Het
Insr T C 8: 3,169,714 D936G probably benign Het
Ints6 A C 14: 62,702,453 V596G probably benign Het
Ispd A T 12: 36,390,482 N130Y probably damaging Het
Kcnj16 A G 11: 111,024,851 D113G possibly damaging Het
Kdm4b A T 17: 56,399,771 I928F probably damaging Het
Lrrc41 C T 4: 116,075,291 probably benign Het
Lrrc8e G A 8: 4,235,070 V432I probably benign Het
Mamdc4 T C 2: 25,568,489 E336G probably benign Het
Maml2 C A 9: 13,621,622 Q711K Het
Map3k14 T C 11: 103,227,672 T563A possibly damaging Het
Mcu T A 10: 59,467,713 K101* probably null Het
Mettl22 T A 16: 8,485,928 V286E probably damaging Het
Mon2 A T 10: 123,009,611 N1396K possibly damaging Het
Mprip T C 11: 59,697,025 probably benign Het
Mrpl51 C T 6: 125,193,381 L117F probably damaging Het
Naalad2 A T 9: 18,385,934 probably benign Het
Nacad T C 11: 6,602,853 T113A probably benign Het
Nrap T A 19: 56,364,411 probably benign Het
Olfr1134 T C 2: 87,656,247 I225V possibly damaging Het
Olfr1336 T C 7: 6,460,764 L85P probably damaging Het
Olfr1358 G A 10: 78,520,450 V281M possibly damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr30 T C 11: 58,455,110 T280A possibly damaging Het
Olfr661 T A 7: 104,688,180 I55N probably damaging Het
Osbpl3 T C 6: 50,351,872 D117G probably damaging Het
Parp9 C T 16: 35,953,611 R318* probably null Het
Pcdhb18 A G 18: 37,490,321 I235V probably benign Het
Pex16 T G 2: 92,379,021 probably benign Het
Piezo2 T A 18: 63,114,963 M489L probably benign Het
Pmepa1 C A 2: 173,227,835 G271V probably damaging Het
Safb A G 17: 56,603,579 E659G unknown Het
Scn9a T C 2: 66,501,666 T1289A probably damaging Het
Secisbp2l T C 2: 125,775,676 D27G possibly damaging Het
Serpina1f A G 12: 103,693,981 V14A probably benign Het
Serpinb9b C A 13: 33,029,469 T3N possibly damaging Het
Sfxn5 C T 6: 85,229,200 M315I probably benign Het
Slc9b2 A G 3: 135,329,769 D333G probably benign Het
Sostdc1 A G 12: 36,317,230 N135S possibly damaging Het
Spg11 T G 2: 122,070,944 D1505A probably damaging Het
Taar7a T C 10: 23,993,381 N34S probably benign Het
Tcerg1l C A 7: 138,209,797 R556L possibly damaging Het
Tcp11l1 T C 2: 104,688,418 K311R probably benign Het
Tepp A T 8: 95,321,255 probably benign Het
Trbv16 T G 6: 41,152,038 F52C probably damaging Het
Ttn T A 2: 76,895,672 R6073S unknown Het
Uba1y T C Y: 828,818 I542T possibly damaging Het
Vmn1r214 T C 13: 23,034,912 I192T probably benign Het
Vmn2r67 C T 7: 85,137,138 C553Y probably damaging Het
Zdhhc17 G T 10: 110,948,260 H452N possibly damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
R8474:Myo1d UTSW 11 80670919 missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80684379 missense probably damaging 1.00
R8810:Myo1d UTSW 11 80676932 missense probably benign 0.30
R8823:Myo1d UTSW 11 80601745 missense possibly damaging 0.91
R9221:Myo1d UTSW 11 80674918 missense probably damaging 1.00
R9494:Myo1d UTSW 11 80484267 missense probably benign 0.02
R9625:Myo1d UTSW 11 80557470 missense possibly damaging 0.95
R9626:Myo1d UTSW 11 80557470 missense possibly damaging 0.95
R9628:Myo1d UTSW 11 80557470 missense possibly damaging 0.95
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTCAAAGCTACAGGAGACAG -3'
(R):5'- ATCTGGGAATAGGTGATGTGCATTC -3'

Sequencing Primer
(F):5'- CTCAAAGCTACAGGAGACAGAAAATG -3'
(R):5'- GGAATAGGTGATGTGCATTCTAATC -3'
Posted On 2021-04-30