Incidental Mutation 'R8810:Gm11639'
ID 672369
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Name predicted gene 11639
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 104685707-105117394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104914895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 3076 (N3076I)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000212287]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000212287
AA Change: N3076I
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,704 S1408P probably damaging Het
Acap3 T C 4: 155,905,712 V783A probably damaging Het
Akap8 T C 17: 32,306,530 N525S probably damaging Het
Aqp1 C T 6: 55,336,621 T44M probably damaging Het
Arap1 T C 7: 101,404,378 Y1305H probably damaging Het
Atg2a T G 19: 6,250,621 S743A probably benign Het
AW551984 G T 9: 39,600,011 L133I probably damaging Het
Bahcc1 C A 11: 120,273,761 P802T possibly damaging Het
Brd8 C A 18: 34,609,949 V288L probably benign Het
Carmil2 T C 8: 105,686,315 probably null Het
Catspere2 G A 1: 178,077,482 E153K possibly damaging Het
Ccdc162 C T 10: 41,666,741 R379Q probably benign Het
Cdh16 A G 8: 104,614,504 L116P probably damaging Het
Cenpj A T 14: 56,558,619 H260Q possibly damaging Het
Cenpq A G 17: 40,933,136 V17A possibly damaging Het
Cep350 T C 1: 155,928,116 K1074E probably damaging Het
Chil4 C A 3: 106,201,805 C394F probably damaging Het
Chst9 T C 18: 15,717,926 I28V probably benign Het
Clasp2 C A 9: 113,899,581 N873K probably damaging Het
Clec4b2 T A 6: 123,181,310 M45K probably benign Het
Cmya5 T A 13: 93,063,540 T3427S possibly damaging Het
Cnih4 A G 1: 181,162,212 Y130C probably damaging Het
Cpne9 T A 6: 113,304,545 M529K probably damaging Het
Ctsr T A 13: 61,161,825 Y190F probably damaging Het
Cyp2j13 G A 4: 96,056,916 H351Y probably benign Het
Dixdc1 T A 9: 50,701,965 Q230L probably damaging Het
Dpep1 A T 8: 123,200,025 I226F probably benign Het
Ehd2 A G 7: 15,957,678 V243A probably benign Het
Etnk2 T A 1: 133,378,494 Y353N probably benign Het
Fgg G T 3: 83,013,015 G367V probably damaging Het
Gm609 T C 16: 45,443,836 T120A probably benign Het
Gm9772 T C 17: 22,006,329 *61Q probably null Het
Grk5 T G 19: 61,089,994 D496E possibly damaging Het
Hc T C 2: 35,019,523 N915S probably benign Het
Iah1 G T 12: 21,317,387 Q31H probably benign Het
Insr T C 8: 3,169,714 D936G probably benign Het
Ints6 A C 14: 62,702,453 V596G probably benign Het
Ispd A T 12: 36,390,482 N130Y probably damaging Het
Kcnj16 A G 11: 111,024,851 D113G possibly damaging Het
Kdm4b A T 17: 56,399,771 I928F probably damaging Het
Lrrc41 C T 4: 116,075,291 probably benign Het
Lrrc8e G A 8: 4,235,070 V432I probably benign Het
Mamdc4 T C 2: 25,568,489 E336G probably benign Het
Maml2 C A 9: 13,621,622 Q711K Het
Map3k14 T C 11: 103,227,672 T563A possibly damaging Het
Mcu T A 10: 59,467,713 K101* probably null Het
Mettl22 T A 16: 8,485,928 V286E probably damaging Het
Mon2 A T 10: 123,009,611 N1396K possibly damaging Het
Mprip T C 11: 59,697,025 probably benign Het
Mrpl51 C T 6: 125,193,381 L117F probably damaging Het
Myo1d C A 11: 80,674,932 V356F probably damaging Het
Myo1d T A 11: 80,676,932 I241F probably benign Het
Naalad2 A T 9: 18,385,934 probably benign Het
Nacad T C 11: 6,602,853 T113A probably benign Het
Nrap T A 19: 56,364,411 probably benign Het
Olfr1134 T C 2: 87,656,247 I225V possibly damaging Het
Olfr1336 T C 7: 6,460,764 L85P probably damaging Het
Olfr1358 G A 10: 78,520,450 V281M possibly damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr30 T C 11: 58,455,110 T280A possibly damaging Het
Olfr661 T A 7: 104,688,180 I55N probably damaging Het
Osbpl3 T C 6: 50,351,872 D117G probably damaging Het
Parp9 C T 16: 35,953,611 R318* probably null Het
Pcdhb18 A G 18: 37,490,321 I235V probably benign Het
Pex16 T G 2: 92,379,021 probably benign Het
Piezo2 T A 18: 63,114,963 M489L probably benign Het
Pmepa1 C A 2: 173,227,835 G271V probably damaging Het
Safb A G 17: 56,603,579 E659G unknown Het
Scn9a T C 2: 66,501,666 T1289A probably damaging Het
Secisbp2l T C 2: 125,775,676 D27G possibly damaging Het
Serpina1f A G 12: 103,693,981 V14A probably benign Het
Serpinb9b C A 13: 33,029,469 T3N possibly damaging Het
Sfxn5 C T 6: 85,229,200 M315I probably benign Het
Slc9b2 A G 3: 135,329,769 D333G probably benign Het
Sostdc1 A G 12: 36,317,230 N135S possibly damaging Het
Spg11 T G 2: 122,070,944 D1505A probably damaging Het
Taar7a T C 10: 23,993,381 N34S probably benign Het
Tcerg1l C A 7: 138,209,797 R556L possibly damaging Het
Tcp11l1 T C 2: 104,688,418 K311R probably benign Het
Tepp A T 8: 95,321,255 probably benign Het
Trbv16 T G 6: 41,152,038 F52C probably damaging Het
Ttn T A 2: 76,895,672 R6073S unknown Het
Uba1y T C Y: 828,818 I542T possibly damaging Het
Vmn1r214 T C 13: 23,034,912 I192T probably benign Het
Vmn2r67 C T 7: 85,137,138 C553Y probably damaging Het
Zdhhc17 G T 10: 110,948,260 H452N possibly damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 splice site probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 splice site probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7682:Gm11639 UTSW 11 104964348 splice site probably null
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
R7840:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7846:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7893:Gm11639 UTSW 11 104979360 missense unknown
R7897:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R7936:Gm11639 UTSW 11 104999698 missense possibly damaging 0.89
R7936:Gm11639 UTSW 11 105046559 critical splice donor site probably null
R7959:Gm11639 UTSW 11 105042801 missense probably damaging 0.96
R8031:Gm11639 UTSW 11 104881469 missense possibly damaging 0.49
R8041:Gm11639 UTSW 11 104919479 missense unknown
R8054:Gm11639 UTSW 11 104730400 missense probably benign 0.07
R8056:Gm11639 UTSW 11 104909070 missense probably damaging 0.98
R8088:Gm11639 UTSW 11 104998246 missense probably benign 0.10
R8112:Gm11639 UTSW 11 104950200 missense unknown
R8340:Gm11639 UTSW 11 104986030 missense unknown
R8405:Gm11639 UTSW 11 104721198 missense probably benign 0.02
R8413:Gm11639 UTSW 11 104920309 missense unknown
R8472:Gm11639 UTSW 11 104818637 missense probably benign 0.07
R8549:Gm11639 UTSW 11 104999695 missense probably damaging 0.99
R8699:Gm11639 UTSW 11 104781246 missense probably benign 0.03
R8711:Gm11639 UTSW 11 104852545 missense probably benign 0.03
R8732:Gm11639 UTSW 11 104804274 missense probably benign 0.03
R8745:Gm11639 UTSW 11 104858478 missense possibly damaging 0.57
R8806:Gm11639 UTSW 11 105037869 missense probably benign 0.07
R8845:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R8870:Gm11639 UTSW 11 104900674 missense probably benign 0.07
R8872:Gm11639 UTSW 11 104870054 missense probably benign 0.19
R8879:Gm11639 UTSW 11 104690955 missense probably benign 0.03
R8924:Gm11639 UTSW 11 104915427 frame shift probably null
R8954:Gm11639 UTSW 11 105018699 critical splice donor site probably null
R8960:Gm11639 UTSW 11 104929946 splice site probably benign
R8975:Gm11639 UTSW 11 105063589 missense probably benign 0.17
R8988:Gm11639 UTSW 11 105020526 missense probably benign 0.07
R8998:Gm11639 UTSW 11 104749651 missense probably benign 0.09
R8999:Gm11639 UTSW 11 104749651 missense probably benign 0.09
R9002:Gm11639 UTSW 11 105029996 missense probably damaging 0.99
R9012:Gm11639 UTSW 11 104820521 critical splice donor site probably null
R9036:Gm11639 UTSW 11 105036775 missense probably benign 0.03
R9037:Gm11639 UTSW 11 104912965 missense unknown
R9059:Gm11639 UTSW 11 104751863 missense possibly damaging 0.73
R9066:Gm11639 UTSW 11 104740862 intron probably benign
R9122:Gm11639 UTSW 11 104965779 missense unknown
R9125:Gm11639 UTSW 11 104845534 missense probably damaging 1.00
R9127:Gm11639 UTSW 11 104850581 missense probably benign 0.07
R9171:Gm11639 UTSW 11 104909882 missense probably benign 0.36
R9219:Gm11639 UTSW 11 104945865 missense unknown
R9224:Gm11639 UTSW 11 104770975 missense probably benign 0.07
R9235:Gm11639 UTSW 11 105017161 missense probably benign 0.19
R9294:Gm11639 UTSW 11 104831300 missense probably benign 0.24
R9318:Gm11639 UTSW 11 104965822 critical splice donor site probably null
R9322:Gm11639 UTSW 11 104874373 missense probably benign 0.36
R9361:Gm11639 UTSW 11 105005698 missense probably benign 0.03
R9408:Gm11639 UTSW 11 104730429 critical splice donor site probably null
R9434:Gm11639 UTSW 11 105009037 missense probably benign 0.24
R9477:Gm11639 UTSW 11 104945872 missense unknown
R9658:Gm11639 UTSW 11 104720294 missense probably benign 0.03
R9719:Gm11639 UTSW 11 104977086 missense unknown
R9751:Gm11639 UTSW 11 104893085 missense probably benign 0.19
R9763:Gm11639 UTSW 11 104999659 missense possibly damaging 0.89
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Z1176:Gm11639 UTSW 11 105001967 missense probably benign 0.29
Z1177:Gm11639 UTSW 11 104739338 nonsense probably null
Z1177:Gm11639 UTSW 11 104820518 missense probably benign 0.03
Z1177:Gm11639 UTSW 11 104924019 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTAAAGGCAGCCATAGTG -3'
(R):5'- CCCCTTCTGGTAAAGTTTGGG -3'

Sequencing Primer
(F):5'- ACATGTGGGAATAGTCCTAACATAG -3'
(R):5'- CCTTCTGGTAAAGTTTGGGAAAATTC -3'
Posted On 2021-04-30