Incidental Mutation 'R8810:Sostdc1'
ID 672373
Institutional Source Beutler Lab
Gene Symbol Sostdc1
Ensembl Gene ENSMUSG00000036169
Gene Name sclerostin domain containing 1
Synonyms ectodin, Sostl, Wise, USAG-1
MMRRC Submission 068725-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 36364168-36368451 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36367229 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 135 (N135S)
Ref Sequence ENSEMBL: ENSMUSP00000040230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041407]
AlphaFold Q9CQN4
Predicted Effect possibly damaging
Transcript: ENSMUST00000041407
AA Change: N135S

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040230
Gene: ENSMUSG00000036169
AA Change: N135S

DomainStartEndE-ValueType
Pfam:Sclerostin 6 206 2.1e-112 PFAM
Pfam:DAN 47 168 3.2e-17 PFAM
Pfam:Cys_knot 72 185 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the sclerostin family and encodes an N-glycosylated, secreted protein with a C-terminal cystine knot-like domain. This protein functions as a bone morphogenetic protein (BMP) antagonist. Specifically, it directly associates with BMPs, prohibiting them from binding their receptors, thereby regulating BMP signaling during cellular proliferation, differentiation, and programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause variable defects in many aspects of tooth development, including tooth number, size and cusp pattern. Observed phenotypes may include cranial and palatal defects, neonatal death, altered trigeminal ganglion morphology, and resistance to cisplatin-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 78,749,452 (GRCm39) S1408P probably damaging Het
Acap3 T C 4: 155,990,169 (GRCm39) V783A probably damaging Het
Akap8 T C 17: 32,525,504 (GRCm39) N525S probably damaging Het
Aqp1 C T 6: 55,313,606 (GRCm39) T44M probably damaging Het
Arap1 T C 7: 101,053,585 (GRCm39) Y1305H probably damaging Het
Atg2a T G 19: 6,300,651 (GRCm39) S743A probably benign Het
AW551984 G T 9: 39,511,307 (GRCm39) L133I probably damaging Het
Bahcc1 C A 11: 120,164,587 (GRCm39) P802T possibly damaging Het
Brd8 C A 18: 34,743,002 (GRCm39) V288L probably benign Het
Carmil2 T C 8: 106,412,947 (GRCm39) probably null Het
Catspere2 G A 1: 177,905,048 (GRCm39) E153K possibly damaging Het
Ccdc162 C T 10: 41,542,737 (GRCm39) R379Q probably benign Het
Cd200l1 T C 16: 45,264,199 (GRCm39) T120A probably benign Het
Cdh16 A G 8: 105,341,136 (GRCm39) L116P probably damaging Het
Cenpj A T 14: 56,796,076 (GRCm39) H260Q possibly damaging Het
Cenpq A G 17: 41,244,027 (GRCm39) V17A possibly damaging Het
Cep350 T C 1: 155,803,862 (GRCm39) K1074E probably damaging Het
Chil4 C A 3: 106,109,121 (GRCm39) C394F probably damaging Het
Chst9 T C 18: 15,850,983 (GRCm39) I28V probably benign Het
Clasp2 C A 9: 113,728,649 (GRCm39) N873K probably damaging Het
Clec4b2 T A 6: 123,158,269 (GRCm39) M45K probably benign Het
Cmya5 T A 13: 93,200,048 (GRCm39) T3427S possibly damaging Het
Cnih4 A G 1: 180,989,777 (GRCm39) Y130C probably damaging Het
Cpne9 T A 6: 113,281,506 (GRCm39) M529K probably damaging Het
Crppa A T 12: 36,440,481 (GRCm39) N130Y probably damaging Het
Ctsr T A 13: 61,309,639 (GRCm39) Y190F probably damaging Het
Cyp2j13 G A 4: 95,945,153 (GRCm39) H351Y probably benign Het
Dixdc1 T A 9: 50,613,265 (GRCm39) Q230L probably damaging Het
Dpep1 A T 8: 123,926,764 (GRCm39) I226F probably benign Het
Efcab3 A T 11: 104,805,721 (GRCm39) N3076I unknown Het
Ehd2 A G 7: 15,691,603 (GRCm39) V243A probably benign Het
Etnk2 T A 1: 133,306,232 (GRCm39) Y353N probably benign Het
Fgg G T 3: 82,920,322 (GRCm39) G367V probably damaging Het
Gm9772 T C 17: 22,225,310 (GRCm39) *61Q probably null Het
Grk5 T G 19: 61,078,432 (GRCm39) D496E possibly damaging Het
Hc T C 2: 34,909,535 (GRCm39) N915S probably benign Het
Iah1 G T 12: 21,367,388 (GRCm39) Q31H probably benign Het
Insr T C 8: 3,219,714 (GRCm39) D936G probably benign Het
Ints6 A C 14: 62,939,902 (GRCm39) V596G probably benign Het
Kcnj16 A G 11: 110,915,677 (GRCm39) D113G possibly damaging Het
Kdm4b A T 17: 56,706,771 (GRCm39) I928F probably damaging Het
Lrrc41 C T 4: 115,932,488 (GRCm39) probably benign Het
Lrrc8e G A 8: 4,285,070 (GRCm39) V432I probably benign Het
Mamdc4 T C 2: 25,458,501 (GRCm39) E336G probably benign Het
Maml2 C A 9: 13,532,918 (GRCm39) Q711K Het
Map3k14 T C 11: 103,118,498 (GRCm39) T563A possibly damaging Het
Mcu T A 10: 59,303,535 (GRCm39) K101* probably null Het
Mettl22 T A 16: 8,303,792 (GRCm39) V286E probably damaging Het
Mon2 A T 10: 122,845,516 (GRCm39) N1396K possibly damaging Het
Mprip T C 11: 59,587,851 (GRCm39) probably benign Het
Mrpl51 C T 6: 125,170,344 (GRCm39) L117F probably damaging Het
Myo1d C A 11: 80,565,758 (GRCm39) V356F probably damaging Het
Myo1d T A 11: 80,567,758 (GRCm39) I241F probably benign Het
Naalad2 A T 9: 18,297,230 (GRCm39) probably benign Het
Nacad T C 11: 6,552,853 (GRCm39) T113A probably benign Het
Nrap T A 19: 56,352,843 (GRCm39) probably benign Het
Or10b1 G A 10: 78,356,284 (GRCm39) V281M possibly damaging Het
Or2z2 T C 11: 58,345,936 (GRCm39) T280A possibly damaging Het
Or56b2 T A 7: 104,337,387 (GRCm39) I55N probably damaging Het
Or5ae1 T A 7: 84,565,626 (GRCm39) I213N possibly damaging Het
Or5w1 T C 2: 87,486,591 (GRCm39) I225V possibly damaging Het
Or6z3 T C 7: 6,463,763 (GRCm39) L85P probably damaging Het
Osbpl3 T C 6: 50,328,852 (GRCm39) D117G probably damaging Het
Parp9 C T 16: 35,773,981 (GRCm39) R318* probably null Het
Pcdhb18 A G 18: 37,623,374 (GRCm39) I235V probably benign Het
Pex16 T G 2: 92,209,366 (GRCm39) probably benign Het
Piezo2 T A 18: 63,248,034 (GRCm39) M489L probably benign Het
Pmepa1 C A 2: 173,069,628 (GRCm39) G271V probably damaging Het
Safb A G 17: 56,910,579 (GRCm39) E659G unknown Het
Scn9a T C 2: 66,332,010 (GRCm39) T1289A probably damaging Het
Secisbp2l T C 2: 125,617,596 (GRCm39) D27G possibly damaging Het
Serpina1f A G 12: 103,660,240 (GRCm39) V14A probably benign Het
Serpinb9b C A 13: 33,213,452 (GRCm39) T3N possibly damaging Het
Sfxn5 C T 6: 85,206,182 (GRCm39) M315I probably benign Het
Slc9b2 A G 3: 135,035,530 (GRCm39) D333G probably benign Het
Spg11 T G 2: 121,901,425 (GRCm39) D1505A probably damaging Het
Spmip8 A T 8: 96,047,883 (GRCm39) probably benign Het
Taar7a T C 10: 23,869,279 (GRCm39) N34S probably benign Het
Tcerg1l C A 7: 137,811,526 (GRCm39) R556L possibly damaging Het
Tcp11l1 T C 2: 104,518,763 (GRCm39) K311R probably benign Het
Trbv16 T G 6: 41,128,972 (GRCm39) F52C probably damaging Het
Ttn T A 2: 76,726,016 (GRCm39) R6073S unknown Het
Uba1y T C Y: 828,818 (GRCm39) I542T possibly damaging Het
Vmn1r214 T C 13: 23,219,082 (GRCm39) I192T probably benign Het
Vmn2r67 C T 7: 84,786,346 (GRCm39) C553Y probably damaging Het
Zdhhc17 G T 10: 110,784,121 (GRCm39) H452N possibly damaging Het
Other mutations in Sostdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Sostdc1 APN 12 36,367,121 (GRCm39) missense probably damaging 1.00
R0588:Sostdc1 UTSW 12 36,367,020 (GRCm39) splice site probably benign
R0671:Sostdc1 UTSW 12 36,367,340 (GRCm39) missense probably damaging 0.99
R2184:Sostdc1 UTSW 12 36,367,295 (GRCm39) missense probably damaging 0.97
R4320:Sostdc1 UTSW 12 36,367,419 (GRCm39) missense probably benign 0.04
R4480:Sostdc1 UTSW 12 36,367,165 (GRCm39) missense probably damaging 0.99
R5511:Sostdc1 UTSW 12 36,367,165 (GRCm39) missense probably damaging 1.00
R5589:Sostdc1 UTSW 12 36,367,246 (GRCm39) nonsense probably null
R5665:Sostdc1 UTSW 12 36,364,407 (GRCm39) missense probably benign 0.39
R6453:Sostdc1 UTSW 12 36,364,407 (GRCm39) missense probably benign 0.39
R6752:Sostdc1 UTSW 12 36,364,411 (GRCm39) missense probably benign 0.00
R7232:Sostdc1 UTSW 12 36,367,310 (GRCm39) missense possibly damaging 0.87
R9019:Sostdc1 UTSW 12 36,364,431 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCGGTCCACCAAATACATTTC -3'
(R):5'- TCAGTCCAGGTCTAGCTCAG -3'

Sequencing Primer
(F):5'- ATACATTTCGGACGGCCAGTG -3'
(R):5'- AGCTCAGACTGTGCTTGC -3'
Posted On 2021-04-30