Mutagenetix > Incidental Mutation

Incidental Mutation 'R8810:Cenpj'

672380

Institutional Source

Beutler Lab

Gene Symbol

Cenpj

Ensembl Gene

ENSMUSG00000064128

Gene Name

centromere protein J

Synonyms

4932437H03Rik, Sas4

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8810 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

56526761-56575425 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56558619 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 260 (H260Q)

Ref Sequence

ENSEMBL: ENSMUSP00000065949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065302] [ENSMUST00000225951]

AlphaFold

Q569L8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065302
AA Change: H260Q

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000065949
Gene: ENSMUSG00000064128
AA Change: H260Q

Domain	Start	End	E-Value	Type
low complexity region	60	76	N/A	INTRINSIC
coiled coil region	140	185	N/A	INTRINSIC
low complexity region	330	350	N/A	INTRINSIC
low complexity region	547	570	N/A	INTRINSIC
low complexity region	860	871	N/A	INTRINSIC
coiled coil region	899	1046	N/A	INTRINSIC
low complexity region	1144	1154	N/A	INTRINSIC
Pfam:Tcp10_C	1167	1342	5.1e-90	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225951
AA Change: H260Q

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for null alleles exhibit embryonic lethality during early organogenesis and may show failure of embryo turning and absence of centrioles, cilia and centrosomes. Mice homozygous for a hypomorphic allele display partial lethality, dwarfism and a wide range of abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,704	S1408P	probably damaging	Het
Acap3	T	C	4: 155,905,712	V783A	probably damaging	Het
Akap8	T	C	17: 32,306,530	N525S	probably damaging	Het
Aqp1	C	T	6: 55,336,621	T44M	probably damaging	Het
Arap1	T	C	7: 101,404,378	Y1305H	probably damaging	Het
Atg2a	T	G	19: 6,250,621	S743A	probably benign	Het
AW551984	G	T	9: 39,600,011	L133I	probably damaging	Het
Bahcc1	C	A	11: 120,273,761	P802T	possibly damaging	Het
Brd8	C	A	18: 34,609,949	V288L	probably benign	Het
Carmil2	T	C	8: 105,686,315		probably null	Het
Catspere2	G	A	1: 178,077,482	E153K	possibly damaging	Het
Ccdc162	C	T	10: 41,666,741	R379Q	probably benign	Het
Cdh16	A	G	8: 104,614,504	L116P	probably damaging	Het
Cenpq	A	G	17: 40,933,136	V17A	possibly damaging	Het
Cep350	T	C	1: 155,928,116	K1074E	probably damaging	Het
Chil4	C	A	3: 106,201,805	C394F	probably damaging	Het
Chst9	T	C	18: 15,717,926	I28V	probably benign	Het
Clasp2	C	A	9: 113,899,581	N873K	probably damaging	Het
Clec4b2	T	A	6: 123,181,310	M45K	probably benign	Het
Cmya5	T	A	13: 93,063,540	T3427S	possibly damaging	Het
Cnih4	A	G	1: 181,162,212	Y130C	probably damaging	Het
Cpne9	T	A	6: 113,304,545	M529K	probably damaging	Het
Ctsr	T	A	13: 61,161,825	Y190F	probably damaging	Het
Cyp2j13	G	A	4: 96,056,916	H351Y	probably benign	Het
Dixdc1	T	A	9: 50,701,965	Q230L	probably damaging	Het
Dpep1	A	T	8: 123,200,025	I226F	probably benign	Het
Ehd2	A	G	7: 15,957,678	V243A	probably benign	Het
Etnk2	T	A	1: 133,378,494	Y353N	probably benign	Het
Fgg	G	T	3: 83,013,015	G367V	probably damaging	Het
Gm11639	A	T	11: 104,914,895	N3076I	unknown	Het
Gm609	T	C	16: 45,443,836	T120A	probably benign	Het
Gm9772	T	C	17: 22,006,329	*61Q	probably null	Het
Grk5	T	G	19: 61,089,994	D496E	possibly damaging	Het
Hc	T	C	2: 35,019,523	N915S	probably benign	Het
Iah1	G	T	12: 21,317,387	Q31H	probably benign	Het
Insr	T	C	8: 3,169,714	D936G	probably benign	Het
Ints6	A	C	14: 62,702,453	V596G	probably benign	Het
Ispd	A	T	12: 36,390,482	N130Y	probably damaging	Het
Kcnj16	A	G	11: 111,024,851	D113G	possibly damaging	Het
Kdm4b	A	T	17: 56,399,771	I928F	probably damaging	Het
Lrrc41	C	T	4: 116,075,291		probably benign	Het
Lrrc8e	G	A	8: 4,235,070	V432I	probably benign	Het
Mamdc4	T	C	2: 25,568,489	E336G	probably benign	Het
Maml2	C	A	9: 13,621,622	Q711K		Het
Map3k14	T	C	11: 103,227,672	T563A	possibly damaging	Het
Mcu	T	A	10: 59,467,713	K101*	probably null	Het
Mettl22	T	A	16: 8,485,928	V286E	probably damaging	Het
Mon2	A	T	10: 123,009,611	N1396K	possibly damaging	Het
Mprip	T	C	11: 59,697,025		probably benign	Het
Mrpl51	C	T	6: 125,193,381	L117F	probably damaging	Het
Myo1d	C	A	11: 80,674,932	V356F	probably damaging	Het
Myo1d	T	A	11: 80,676,932	I241F	probably benign	Het
Naalad2	A	T	9: 18,385,934		probably benign	Het
Nacad	T	C	11: 6,602,853	T113A	probably benign	Het
Nrap	T	A	19: 56,364,411		probably benign	Het
Olfr1134	T	C	2: 87,656,247	I225V	possibly damaging	Het
Olfr1336	T	C	7: 6,460,764	L85P	probably damaging	Het
Olfr1358	G	A	10: 78,520,450	V281M	possibly damaging	Het
Olfr290	T	A	7: 84,916,418	I213N	possibly damaging	Het
Olfr30	T	C	11: 58,455,110	T280A	possibly damaging	Het
Olfr661	T	A	7: 104,688,180	I55N	probably damaging	Het
Osbpl3	T	C	6: 50,351,872	D117G	probably damaging	Het
Parp9	C	T	16: 35,953,611	R318*	probably null	Het
Pcdhb18	A	G	18: 37,490,321	I235V	probably benign	Het
Pex16	T	G	2: 92,379,021		probably benign	Het
Piezo2	T	A	18: 63,114,963	M489L	probably benign	Het
Pmepa1	C	A	2: 173,227,835	G271V	probably damaging	Het
Safb	A	G	17: 56,603,579	E659G	unknown	Het
Scn9a	T	C	2: 66,501,666	T1289A	probably damaging	Het
Secisbp2l	T	C	2: 125,775,676	D27G	possibly damaging	Het
Serpina1f	A	G	12: 103,693,981	V14A	probably benign	Het
Serpinb9b	C	A	13: 33,029,469	T3N	possibly damaging	Het
Sfxn5	C	T	6: 85,229,200	M315I	probably benign	Het
Slc9b2	A	G	3: 135,329,769	D333G	probably benign	Het
Sostdc1	A	G	12: 36,317,230	N135S	possibly damaging	Het
Spg11	T	G	2: 122,070,944	D1505A	probably damaging	Het
Taar7a	T	C	10: 23,993,381	N34S	probably benign	Het
Tcerg1l	C	A	7: 138,209,797	R556L	possibly damaging	Het
Tcp11l1	T	C	2: 104,688,418	K311R	probably benign	Het
Tepp	A	T	8: 95,321,255		probably benign	Het
Trbv16	T	G	6: 41,152,038	F52C	probably damaging	Het
Ttn	T	A	2: 76,895,672	R6073S	unknown	Het
Uba1y	T	C	Y: 828,818	I542T	possibly damaging	Het
Vmn1r214	T	C	13: 23,034,912	I192T	probably benign	Het
Vmn2r67	C	T	7: 85,137,138	C553Y	probably damaging	Het
Zdhhc17	G	T	10: 110,948,260	H452N	possibly damaging	Het

Other mutations in Cenpj

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Cenpj	APN	14	56553030	missense	probably benign	0.04
IGL00969:Cenpj	APN	14	56564963	missense	possibly damaging	0.68
IGL01152:Cenpj	APN	14	56552300	missense	probably benign	0.01
IGL01475:Cenpj	APN	14	56565045	missense	possibly damaging	0.80
IGL01548:Cenpj	APN	14	56532319	missense	probably benign	0.00
IGL01893:Cenpj	APN	14	56553474	missense	probably damaging	1.00
IGL02647:Cenpj	APN	14	56530079	missense	probably damaging	0.99
IGL02683:Cenpj	APN	14	56552952	missense	possibly damaging	0.88
IGL02691:Cenpj	APN	14	56552090	missense	probably benign	0.28
IGL03008:Cenpj	APN	14	56526949	missense	probably benign	0.39
R0206:Cenpj	UTSW	14	56563970	missense	probably benign	0.00
R0208:Cenpj	UTSW	14	56563970	missense	probably benign	0.00
R0356:Cenpj	UTSW	14	56549496	missense	probably damaging	1.00
R0942:Cenpj	UTSW	14	56555209	unclassified	probably benign
R1392:Cenpj	UTSW	14	56534854	splice site	probably benign
R1564:Cenpj	UTSW	14	56552066	missense	probably benign	0.43
R1671:Cenpj	UTSW	14	56565045	missense	probably damaging	0.99
R1889:Cenpj	UTSW	14	56558725	missense	probably benign	0.43
R2059:Cenpj	UTSW	14	56563955	missense	possibly damaging	0.94
R2140:Cenpj	UTSW	14	56526932	missense	probably damaging	1.00
R2509:Cenpj	UTSW	14	56532237	missense	probably null	0.98
R2866:Cenpj	UTSW	14	56552180	missense	probably benign	0.01
R3813:Cenpj	UTSW	14	56553222	missense	probably benign	0.05
R4620:Cenpj	UTSW	14	56535454	missense	probably damaging	0.99
R4670:Cenpj	UTSW	14	56553383	missense	possibly damaging	0.80
R4671:Cenpj	UTSW	14	56553383	missense	possibly damaging	0.80
R4765:Cenpj	UTSW	14	56549545	nonsense	probably null
R4915:Cenpj	UTSW	14	56553718	missense	probably damaging	0.98
R4930:Cenpj	UTSW	14	56534781	nonsense	probably null
R5088:Cenpj	UTSW	14	56553691	missense	probably damaging	1.00
R5523:Cenpj	UTSW	14	56552423	missense	probably benign	0.00
R5527:Cenpj	UTSW	14	56526983	missense	probably damaging	1.00
R5717:Cenpj	UTSW	14	56553521	frame shift	probably null
R5944:Cenpj	UTSW	14	56553658	critical splice donor site	probably null
R5975:Cenpj	UTSW	14	56564066	missense	possibly damaging	0.92
R6019:Cenpj	UTSW	14	56534815	missense	probably benign	0.01
R6291:Cenpj	UTSW	14	56551976	missense	probably benign	0.01
R6948:Cenpj	UTSW	14	56553226	missense	probably damaging	0.96
R7212:Cenpj	UTSW	14	56552652	missense	probably benign	0.00
R7461:Cenpj	UTSW	14	56527044	nonsense	probably null
R7613:Cenpj	UTSW	14	56527044	nonsense	probably null
R7634:Cenpj	UTSW	14	56542800	missense	probably benign	0.00
R7837:Cenpj	UTSW	14	56558728	missense	probably benign	0.02
R8722:Cenpj	UTSW	14	56535518	missense	probably damaging	1.00
R8813:Cenpj	UTSW	14	56552898	missense	probably damaging	1.00
R8842:Cenpj	UTSW	14	56542872	missense	probably damaging	0.97
R8916:Cenpj	UTSW	14	56552895	missense	probably damaging	1.00
R8987:Cenpj	UTSW	14	56526926	missense	possibly damaging	0.75
R9128:Cenpj	UTSW	14	56542862	missense	probably damaging	1.00
R9227:Cenpj	UTSW	14	56564719	missense	possibly damaging	0.51
R9229:Cenpj	UTSW	14	56564719	missense	possibly damaging	0.51
R9624:Cenpj	UTSW	14	56564930	missense	probably benign	0.01
R9686:Cenpj	UTSW	14	56552591	missense	probably benign	0.01
R9717:Cenpj	UTSW	14	56552996	missense	probably benign	0.02
RF007:Cenpj	UTSW	14	56530048	critical splice donor site	probably null
Z1177:Cenpj	UTSW	14	56552879	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- AGACCCCGTTGCTATCTGTG -3'
(R):5'- CGCTCTCCCGGAGATTTAAC -3'

Sequencing Primer
(F):5'- ATGAGGATCAAGACCTAGCTTC -3'
(R):5'- CCGGAGATTTAACTCTGCCAC -3'

Posted On

2021-04-30