Mutagenetix > Incidental Mutation

Incidental Mutation 'R8810:Ints6'

672381

Institutional Source

Beutler Lab

Gene Symbol

Ints6

Ensembl Gene

ENSMUSG00000035161

Gene Name

integrator complex subunit 6

Synonyms

DICE1, Notch2l, Ddx26, 2900075H24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8810 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62676330-62761169 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 62702453 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 596 (V596G)

Ref Sequence

ENSEMBL: ENSMUSP00000086788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053959] [ENSMUST00000223585]

AlphaFold

Q6PCM2

Predicted Effect

probably benign
Transcript: ENSMUST00000053959
AA Change: V596G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: V596G

Domain	Start	End	E-Value	Type
VWA	1	158	4.11e-1	SMART
Blast:VWA	307	331	1e-7	BLAST
Blast:RRM_2	701	727	3e-8	BLAST
Pfam:INT_SG_DDX_CT_C	803	865	4e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000223585
AA Change: V596G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

Meta Mutation Damage Score

0.0956

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,704	S1408P	probably damaging	Het
Acap3	T	C	4: 155,905,712	V783A	probably damaging	Het
Akap8	T	C	17: 32,306,530	N525S	probably damaging	Het
Aqp1	C	T	6: 55,336,621	T44M	probably damaging	Het
Arap1	T	C	7: 101,404,378	Y1305H	probably damaging	Het
Atg2a	T	G	19: 6,250,621	S743A	probably benign	Het
AW551984	G	T	9: 39,600,011	L133I	probably damaging	Het
Bahcc1	C	A	11: 120,273,761	P802T	possibly damaging	Het
Brd8	C	A	18: 34,609,949	V288L	probably benign	Het
Carmil2	T	C	8: 105,686,315		probably null	Het
Catspere2	G	A	1: 178,077,482	E153K	possibly damaging	Het
Ccdc162	C	T	10: 41,666,741	R379Q	probably benign	Het
Cdh16	A	G	8: 104,614,504	L116P	probably damaging	Het
Cenpj	A	T	14: 56,558,619	H260Q	possibly damaging	Het
Cenpq	A	G	17: 40,933,136	V17A	possibly damaging	Het
Cep350	T	C	1: 155,928,116	K1074E	probably damaging	Het
Chil4	C	A	3: 106,201,805	C394F	probably damaging	Het
Chst9	T	C	18: 15,717,926	I28V	probably benign	Het
Clasp2	C	A	9: 113,899,581	N873K	probably damaging	Het
Clec4b2	T	A	6: 123,181,310	M45K	probably benign	Het
Cmya5	T	A	13: 93,063,540	T3427S	possibly damaging	Het
Cnih4	A	G	1: 181,162,212	Y130C	probably damaging	Het
Cpne9	T	A	6: 113,304,545	M529K	probably damaging	Het
Ctsr	T	A	13: 61,161,825	Y190F	probably damaging	Het
Cyp2j13	G	A	4: 96,056,916	H351Y	probably benign	Het
Dixdc1	T	A	9: 50,701,965	Q230L	probably damaging	Het
Dpep1	A	T	8: 123,200,025	I226F	probably benign	Het
Ehd2	A	G	7: 15,957,678	V243A	probably benign	Het
Etnk2	T	A	1: 133,378,494	Y353N	probably benign	Het
Fgg	G	T	3: 83,013,015	G367V	probably damaging	Het
Gm11639	A	T	11: 104,914,895	N3076I	unknown	Het
Gm609	T	C	16: 45,443,836	T120A	probably benign	Het
Gm9772	T	C	17: 22,006,329	*61Q	probably null	Het
Grk5	T	G	19: 61,089,994	D496E	possibly damaging	Het
Hc	T	C	2: 35,019,523	N915S	probably benign	Het
Iah1	G	T	12: 21,317,387	Q31H	probably benign	Het
Insr	T	C	8: 3,169,714	D936G	probably benign	Het
Ispd	A	T	12: 36,390,482	N130Y	probably damaging	Het
Kcnj16	A	G	11: 111,024,851	D113G	possibly damaging	Het
Kdm4b	A	T	17: 56,399,771	I928F	probably damaging	Het
Lrrc41	C	T	4: 116,075,291		probably benign	Het
Lrrc8e	G	A	8: 4,235,070	V432I	probably benign	Het
Mamdc4	T	C	2: 25,568,489	E336G	probably benign	Het
Maml2	C	A	9: 13,621,622	Q711K		Het
Map3k14	T	C	11: 103,227,672	T563A	possibly damaging	Het
Mcu	T	A	10: 59,467,713	K101*	probably null	Het
Mettl22	T	A	16: 8,485,928	V286E	probably damaging	Het
Mon2	A	T	10: 123,009,611	N1396K	possibly damaging	Het
Mprip	T	C	11: 59,697,025		probably benign	Het
Mrpl51	C	T	6: 125,193,381	L117F	probably damaging	Het
Myo1d	C	A	11: 80,674,932	V356F	probably damaging	Het
Myo1d	T	A	11: 80,676,932	I241F	probably benign	Het
Naalad2	A	T	9: 18,385,934		probably benign	Het
Nacad	T	C	11: 6,602,853	T113A	probably benign	Het
Nrap	T	A	19: 56,364,411		probably benign	Het
Olfr1134	T	C	2: 87,656,247	I225V	possibly damaging	Het
Olfr1336	T	C	7: 6,460,764	L85P	probably damaging	Het
Olfr1358	G	A	10: 78,520,450	V281M	possibly damaging	Het
Olfr290	T	A	7: 84,916,418	I213N	possibly damaging	Het
Olfr30	T	C	11: 58,455,110	T280A	possibly damaging	Het
Olfr661	T	A	7: 104,688,180	I55N	probably damaging	Het
Osbpl3	T	C	6: 50,351,872	D117G	probably damaging	Het
Parp9	C	T	16: 35,953,611	R318*	probably null	Het
Pcdhb18	A	G	18: 37,490,321	I235V	probably benign	Het
Pex16	T	G	2: 92,379,021		probably benign	Het
Piezo2	T	A	18: 63,114,963	M489L	probably benign	Het
Pmepa1	C	A	2: 173,227,835	G271V	probably damaging	Het
Safb	A	G	17: 56,603,579	E659G	unknown	Het
Scn9a	T	C	2: 66,501,666	T1289A	probably damaging	Het
Secisbp2l	T	C	2: 125,775,676	D27G	possibly damaging	Het
Serpina1f	A	G	12: 103,693,981	V14A	probably benign	Het
Serpinb9b	C	A	13: 33,029,469	T3N	possibly damaging	Het
Sfxn5	C	T	6: 85,229,200	M315I	probably benign	Het
Slc9b2	A	G	3: 135,329,769	D333G	probably benign	Het
Sostdc1	A	G	12: 36,317,230	N135S	possibly damaging	Het
Spg11	T	G	2: 122,070,944	D1505A	probably damaging	Het
Taar7a	T	C	10: 23,993,381	N34S	probably benign	Het
Tcerg1l	C	A	7: 138,209,797	R556L	possibly damaging	Het
Tcp11l1	T	C	2: 104,688,418	K311R	probably benign	Het
Tepp	A	T	8: 95,321,255		probably benign	Het
Trbv16	T	G	6: 41,152,038	F52C	probably damaging	Het
Ttn	T	A	2: 76,895,672	R6073S	unknown	Het
Uba1y	T	C	Y: 828,818	I542T	possibly damaging	Het
Vmn1r214	T	C	13: 23,034,912	I192T	probably benign	Het
Vmn2r67	C	T	7: 85,137,138	C553Y	probably damaging	Het
Zdhhc17	G	T	10: 110,948,260	H452N	possibly damaging	Het

Other mutations in Ints6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Ints6	APN	14	62703179	missense	probably damaging	1.00
IGL00763:Ints6	APN	14	62700865	splice site	probably benign
IGL01624:Ints6	APN	14	62696871	missense	probably benign	0.07
IGL01721:Ints6	APN	14	62713739	missense	probably damaging	0.96
IGL02146:Ints6	APN	14	62759260	missense	possibly damaging	0.91
G1Funyon:Ints6	UTSW	14	62702453	missense	probably benign
R0302:Ints6	UTSW	14	62709512	missense	probably damaging	1.00
R0320:Ints6	UTSW	14	62707635	nonsense	probably null
R0543:Ints6	UTSW	14	62696611	missense	probably damaging	1.00
R0554:Ints6	UTSW	14	62704751	missense	possibly damaging	0.87
R0620:Ints6	UTSW	14	62696759	missense	probably benign
R0960:Ints6	UTSW	14	62709566	missense	probably benign	0.39
R1216:Ints6	UTSW	14	62707698	missense	probably damaging	1.00
R1254:Ints6	UTSW	14	62716374	missense	probably benign	0.27
R1296:Ints6	UTSW	14	62704903	splice site	probably benign
R1548:Ints6	UTSW	14	62713692	missense	probably damaging	1.00
R1944:Ints6	UTSW	14	62693640	missense	probably benign	0.03
R2040:Ints6	UTSW	14	62713689	missense	probably damaging	0.99
R2279:Ints6	UTSW	14	62704682	critical splice donor site	probably null
R2844:Ints6	UTSW	14	62704826	missense	probably damaging	0.97
R3107:Ints6	UTSW	14	62760592	missense	possibly damaging	0.92
R3407:Ints6	UTSW	14	62696937	missense	probably benign	0.00
R3895:Ints6	UTSW	14	62696611	missense	probably damaging	1.00
R4608:Ints6	UTSW	14	62703229	missense	probably damaging	1.00
R4903:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R4964:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R4966:Ints6	UTSW	14	62702462	missense	probably damaging	1.00
R5014:Ints6	UTSW	14	62760191	missense	probably benign	0.00
R5369:Ints6	UTSW	14	62743935	missense	probably damaging	1.00
R6478:Ints6	UTSW	14	62700786	missense	probably benign	0.37
R7022:Ints6	UTSW	14	62714337	missense	probably damaging	1.00
R7403:Ints6	UTSW	14	62707655	missense	possibly damaging	0.50
R7422:Ints6	UTSW	14	62704775	missense	probably benign
R7909:Ints6	UTSW	14	62759330	missense	probably damaging	0.99
R8147:Ints6	UTSW	14	62713737	missense	probably damaging	1.00
R8301:Ints6	UTSW	14	62702453	missense	probably benign
R8496:Ints6	UTSW	14	62705876	missense	probably benign	0.06
R8502:Ints6	UTSW	14	62760579	missense	possibly damaging	0.92
R8514:Ints6	UTSW	14	62695717	missense	possibly damaging	0.89
R8540:Ints6	UTSW	14	62696904	missense	probably benign	0.39
R8733:Ints6	UTSW	14	62696848	missense	probably benign	0.01
R8839:Ints6	UTSW	14	62693673	missense	probably benign	0.06
R9057:Ints6	UTSW	14	62714291	critical splice donor site	probably null
R9178:Ints6	UTSW	14	62709587	missense	probably damaging	1.00
R9318:Ints6	UTSW	14	62696698	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTTTAATGAGATATTCCTCCCCAA -3'
(R):5'- ACACGTCTTTATTCATGTGCTAGT -3'

Sequencing Primer
(F):5'- TATTCCTCCCCAAAAATAACTTAAGC -3'
(R):5'- CGTCTTTATTCATGTGCTAGTTTCAC -3'

Posted On

2021-04-30