Incidental Mutation 'R8810:Akap8'
ID 672385
Institutional Source Beutler Lab
Gene Symbol Akap8
Ensembl Gene ENSMUSG00000024045
Gene Name A kinase (PRKA) anchor protein 8
Synonyms 1200016A02Rik, AKAP95
MMRRC Submission 068725-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8810 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 32303676-32321153 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32306530 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 525 (N525S)
Ref Sequence ENSEMBL: ENSMUSP00000002699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002699]
AlphaFold Q9DBR0
Predicted Effect probably damaging
Transcript: ENSMUST00000002699
AA Change: N525S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002699
Gene: ENSMUSG00000024045
AA Change: N525S

DomainStartEndE-ValueType
SCOP:d1a0tp_ 12 108 3e-19 SMART
low complexity region 183 198 N/A INTRINSIC
low complexity region 257 270 N/A INTRINSIC
low complexity region 354 384 N/A INTRINSIC
ZnF_C2H2 387 411 9.46e0 SMART
Blast:ZnF_C2H2 476 501 9e-9 BLAST
low complexity region 551 582 N/A INTRINSIC
low complexity region 642 651 N/A INTRINSIC
Meta Mutation Damage Score 0.6399 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: This gene encodes a member of the A-kinase anchoring protein (AKAP) family. These proteins are characterized by their ability to bind to the R subunit of protein kinase A (PKA) and anchor the protein at different subcellular locations. This protein has been shown to regulate apoptosis and to be involved in palatogenesis. Knockdown of this gene has been associated with altered histone modifications and reduced expression of developmental genes in mouse embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a gene trap insertion are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,704 S1408P probably damaging Het
Acap3 T C 4: 155,905,712 V783A probably damaging Het
Aqp1 C T 6: 55,336,621 T44M probably damaging Het
Arap1 T C 7: 101,404,378 Y1305H probably damaging Het
Atg2a T G 19: 6,250,621 S743A probably benign Het
AW551984 G T 9: 39,600,011 L133I probably damaging Het
Bahcc1 C A 11: 120,273,761 P802T possibly damaging Het
Brd8 C A 18: 34,609,949 V288L probably benign Het
Carmil2 T C 8: 105,686,315 probably null Het
Catspere2 G A 1: 178,077,482 E153K possibly damaging Het
Ccdc162 C T 10: 41,666,741 R379Q probably benign Het
Cdh16 A G 8: 104,614,504 L116P probably damaging Het
Cenpj A T 14: 56,558,619 H260Q possibly damaging Het
Cenpq A G 17: 40,933,136 V17A possibly damaging Het
Cep350 T C 1: 155,928,116 K1074E probably damaging Het
Chil4 C A 3: 106,201,805 C394F probably damaging Het
Chst9 T C 18: 15,717,926 I28V probably benign Het
Clasp2 C A 9: 113,899,581 N873K probably damaging Het
Clec4b2 T A 6: 123,181,310 M45K probably benign Het
Cmya5 T A 13: 93,063,540 T3427S possibly damaging Het
Cnih4 A G 1: 181,162,212 Y130C probably damaging Het
Cpne9 T A 6: 113,304,545 M529K probably damaging Het
Ctsr T A 13: 61,161,825 Y190F probably damaging Het
Cyp2j13 G A 4: 96,056,916 H351Y probably benign Het
Dixdc1 T A 9: 50,701,965 Q230L probably damaging Het
Dpep1 A T 8: 123,200,025 I226F probably benign Het
Ehd2 A G 7: 15,957,678 V243A probably benign Het
Etnk2 T A 1: 133,378,494 Y353N probably benign Het
Fgg G T 3: 83,013,015 G367V probably damaging Het
Gm11639 A T 11: 104,914,895 N3076I unknown Het
Gm609 T C 16: 45,443,836 T120A probably benign Het
Gm9772 T C 17: 22,006,329 *61Q probably null Het
Grk5 T G 19: 61,089,994 D496E possibly damaging Het
Hc T C 2: 35,019,523 N915S probably benign Het
Iah1 G T 12: 21,317,387 Q31H probably benign Het
Insr T C 8: 3,169,714 D936G probably benign Het
Ints6 A C 14: 62,702,453 V596G probably benign Het
Ispd A T 12: 36,390,482 N130Y probably damaging Het
Kcnj16 A G 11: 111,024,851 D113G possibly damaging Het
Kdm4b A T 17: 56,399,771 I928F probably damaging Het
Lrrc41 C T 4: 116,075,291 probably benign Het
Lrrc8e G A 8: 4,235,070 V432I probably benign Het
Mamdc4 T C 2: 25,568,489 E336G probably benign Het
Maml2 C A 9: 13,621,622 Q711K Het
Map3k14 T C 11: 103,227,672 T563A possibly damaging Het
Mcu T A 10: 59,467,713 K101* probably null Het
Mettl22 T A 16: 8,485,928 V286E probably damaging Het
Mon2 A T 10: 123,009,611 N1396K possibly damaging Het
Mprip T C 11: 59,697,025 probably benign Het
Mrpl51 C T 6: 125,193,381 L117F probably damaging Het
Myo1d C A 11: 80,674,932 V356F probably damaging Het
Myo1d T A 11: 80,676,932 I241F probably benign Het
Naalad2 A T 9: 18,385,934 probably benign Het
Nacad T C 11: 6,602,853 T113A probably benign Het
Nrap T A 19: 56,364,411 probably benign Het
Olfr1134 T C 2: 87,656,247 I225V possibly damaging Het
Olfr1336 T C 7: 6,460,764 L85P probably damaging Het
Olfr1358 G A 10: 78,520,450 V281M possibly damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr30 T C 11: 58,455,110 T280A possibly damaging Het
Olfr661 T A 7: 104,688,180 I55N probably damaging Het
Osbpl3 T C 6: 50,351,872 D117G probably damaging Het
Parp9 C T 16: 35,953,611 R318* probably null Het
Pcdhb18 A G 18: 37,490,321 I235V probably benign Het
Pex16 T G 2: 92,379,021 probably benign Het
Piezo2 T A 18: 63,114,963 M489L probably benign Het
Pmepa1 C A 2: 173,227,835 G271V probably damaging Het
Safb A G 17: 56,603,579 E659G unknown Het
Scn9a T C 2: 66,501,666 T1289A probably damaging Het
Secisbp2l T C 2: 125,775,676 D27G possibly damaging Het
Serpina1f A G 12: 103,693,981 V14A probably benign Het
Serpinb9b C A 13: 33,029,469 T3N possibly damaging Het
Sfxn5 C T 6: 85,229,200 M315I probably benign Het
Slc9b2 A G 3: 135,329,769 D333G probably benign Het
Sostdc1 A G 12: 36,317,230 N135S possibly damaging Het
Spg11 T G 2: 122,070,944 D1505A probably damaging Het
Taar7a T C 10: 23,993,381 N34S probably benign Het
Tcerg1l C A 7: 138,209,797 R556L possibly damaging Het
Tcp11l1 T C 2: 104,688,418 K311R probably benign Het
Tepp A T 8: 95,321,255 probably benign Het
Trbv16 T G 6: 41,152,038 F52C probably damaging Het
Ttn T A 2: 76,895,672 R6073S unknown Het
Uba1y T C Y: 828,818 I542T possibly damaging Het
Vmn1r214 T C 13: 23,034,912 I192T probably benign Het
Vmn2r67 C T 7: 85,137,138 C553Y probably damaging Het
Zdhhc17 G T 10: 110,948,260 H452N possibly damaging Het
Other mutations in Akap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Akap8 APN 17 32,317,280 (GRCm38) missense probably damaging 1.00
IGL01450:Akap8 APN 17 32,315,687 (GRCm38) missense probably damaging 1.00
IGL02002:Akap8 APN 17 32,309,496 (GRCm38) missense probably damaging 1.00
IGL02223:Akap8 APN 17 32,316,647 (GRCm38) missense probably damaging 1.00
IGL02315:Akap8 APN 17 32,305,501 (GRCm38) missense probably benign 0.01
IGL03404:Akap8 APN 17 32,312,276 (GRCm38) splice site probably benign
BB006:Akap8 UTSW 17 32,309,445 (GRCm38) missense probably damaging 1.00
BB016:Akap8 UTSW 17 32,309,445 (GRCm38) missense probably damaging 1.00
R0310:Akap8 UTSW 17 32,316,260 (GRCm38) missense possibly damaging 0.81
R0526:Akap8 UTSW 17 32,317,292 (GRCm38) missense probably benign 0.28
R1795:Akap8 UTSW 17 32,315,477 (GRCm38) missense probably damaging 1.00
R1992:Akap8 UTSW 17 32,316,612 (GRCm38) missense probably damaging 0.99
R2571:Akap8 UTSW 17 32,315,455 (GRCm38) missense probably damaging 1.00
R2918:Akap8 UTSW 17 32,305,648 (GRCm38) missense probably benign 0.01
R3423:Akap8 UTSW 17 32,316,455 (GRCm38) missense possibly damaging 0.61
R3870:Akap8 UTSW 17 32,317,839 (GRCm38) unclassified probably benign
R4077:Akap8 UTSW 17 32,312,298 (GRCm38) missense probably damaging 1.00
R4078:Akap8 UTSW 17 32,312,298 (GRCm38) missense probably damaging 1.00
R4379:Akap8 UTSW 17 32,306,560 (GRCm38) missense probably damaging 0.99
R4756:Akap8 UTSW 17 32,316,210 (GRCm38) missense probably damaging 0.98
R4819:Akap8 UTSW 17 32,312,305 (GRCm38) missense probably damaging 1.00
R5091:Akap8 UTSW 17 32,316,234 (GRCm38) missense probably benign 0.05
R5761:Akap8 UTSW 17 32,317,185 (GRCm38) missense possibly damaging 0.56
R6896:Akap8 UTSW 17 32,317,331 (GRCm38) missense probably benign 0.00
R7138:Akap8 UTSW 17 32,316,541 (GRCm38) missense possibly damaging 0.86
R7350:Akap8 UTSW 17 32,316,575 (GRCm38) missense possibly damaging 0.92
R7929:Akap8 UTSW 17 32,309,445 (GRCm38) missense probably damaging 1.00
R8693:Akap8 UTSW 17 32,310,651 (GRCm38) missense probably damaging 1.00
R9521:Akap8 UTSW 17 32,311,062 (GRCm38) missense possibly damaging 0.89
X0020:Akap8 UTSW 17 32,315,750 (GRCm38) missense probably benign 0.08
Z1176:Akap8 UTSW 17 32,306,549 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAAACACCAAGTCTCTGG -3'
(R):5'- ACAGTGCAGACTTGTCTGTG -3'

Sequencing Primer
(F):5'- TCCAAACCTCTGATCGCCG -3'
(R):5'- GCAGACTTGTCTGTGGTTGG -3'
Posted On 2021-04-30