Mutagenetix > Incidental Mutation

Incidental Mutation 'R8810:Piezo2'

672392

Institutional Source

Beutler Lab

Gene Symbol

Piezo2

Ensembl Gene

ENSMUSG00000041482

Gene Name

piezo-type mechanosensitive ion channel component 2

Synonyms

Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik

MMRRC Submission

068725-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8810 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63010213-63387183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63114963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 489 (M489L)

Ref Sequence

ENSEMBL: ENSMUSP00000040019 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046860
AA Change: M489L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: M489L

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000047480
AA Change: M489L

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: M489L

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
internal_repeat_1	740	764	6.01e-5	PROSPERO
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	900	921	N/A	INTRINSIC
transmembrane domain	949	971	N/A	INTRINSIC
transmembrane domain	976	993	N/A	INTRINSIC
transmembrane domain	1000	1022	N/A	INTRINSIC
transmembrane domain	1069	1091	N/A	INTRINSIC
transmembrane domain	1130	1152	N/A	INTRINSIC
transmembrane domain	1156	1173	N/A	INTRINSIC
transmembrane domain	1186	1208	N/A	INTRINSIC
transmembrane domain	1234	1256	N/A	INTRINSIC
transmembrane domain	1308	1327	N/A	INTRINSIC
transmembrane domain	1331	1353	N/A	INTRINSIC
Pfam:PIEZO	1383	1617	1.1e-105	PFAM
low complexity region	1807	1823	N/A	INTRINSIC
low complexity region	1836	1860	N/A	INTRINSIC
low complexity region	1863	1878	N/A	INTRINSIC
transmembrane domain	1981	2003	N/A	INTRINSIC
transmembrane domain	2010	2027	N/A	INTRINSIC
internal_repeat_1	2036	2060	6.01e-5	PROSPERO
low complexity region	2167	2199	N/A	INTRINSIC
transmembrane domain	2261	2283	N/A	INTRINSIC
transmembrane domain	2303	2325	N/A	INTRINSIC
transmembrane domain	2332	2354	N/A	INTRINSIC
transmembrane domain	2364	2386	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2412	2821	2.8e-161	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182233
AA Change: M257L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: M257L

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
transmembrane domain	34	56	N/A	INTRINSIC
coiled coil region	223	250	N/A	INTRINSIC
transmembrane domain	272	294	N/A	INTRINSIC
transmembrane domain	307	329	N/A	INTRINSIC
SCOP:d1eq1a_	365	434	1e-3	SMART
transmembrane domain	450	472	N/A	INTRINSIC
transmembrane domain	476	498	N/A	INTRINSIC
transmembrane domain	505	527	N/A	INTRINSIC
low complexity region	540	552	N/A	INTRINSIC
transmembrane domain	559	581	N/A	INTRINSIC
low complexity region	668	689	N/A	INTRINSIC
transmembrane domain	717	739	N/A	INTRINSIC
transmembrane domain	744	761	N/A	INTRINSIC
transmembrane domain	768	790	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC
transmembrane domain	924	941	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183217
AA Change: M489L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: M489L

Domain	Start	End	E-Value	Type
transmembrane domain	13	44	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
low complexity region	179	194	N/A	INTRINSIC
transmembrane domain	214	236	N/A	INTRINSIC
transmembrane domain	241	260	N/A	INTRINSIC
transmembrane domain	267	289	N/A	INTRINSIC
coiled coil region	455	482	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC
transmembrane domain	539	561	N/A	INTRINSIC
SCOP:d1eq1a_	597	666	4e-3	SMART
transmembrane domain	682	704	N/A	INTRINSIC
transmembrane domain	708	730	N/A	INTRINSIC
transmembrane domain	737	759	N/A	INTRINSIC
low complexity region	772	784	N/A	INTRINSIC
transmembrane domain	791	813	N/A	INTRINSIC
low complexity region	886	907	N/A	INTRINSIC
transmembrane domain	935	957	N/A	INTRINSIC
transmembrane domain	962	979	N/A	INTRINSIC
transmembrane domain	986	1008	N/A	INTRINSIC
transmembrane domain	1055	1077	N/A	INTRINSIC
transmembrane domain	1116	1138	N/A	INTRINSIC
transmembrane domain	1142	1159	N/A	INTRINSIC
transmembrane domain	1172	1194	N/A	INTRINSIC
transmembrane domain	1220	1242	N/A	INTRINSIC
transmembrane domain	1294	1313	N/A	INTRINSIC
transmembrane domain	1317	1339	N/A	INTRINSIC
transmembrane domain	1352	1374	N/A	INTRINSIC
coiled coil region	1460	1501	N/A	INTRINSIC
low complexity region	1528	1537	N/A	INTRINSIC
low complexity region	1558	1575	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

99% (82/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,704	S1408P	probably damaging	Het
Acap3	T	C	4: 155,905,712	V783A	probably damaging	Het
Akap8	T	C	17: 32,306,530	N525S	probably damaging	Het
Aqp1	C	T	6: 55,336,621	T44M	probably damaging	Het
Arap1	T	C	7: 101,404,378	Y1305H	probably damaging	Het
Atg2a	T	G	19: 6,250,621	S743A	probably benign	Het
AW551984	G	T	9: 39,600,011	L133I	probably damaging	Het
Bahcc1	C	A	11: 120,273,761	P802T	possibly damaging	Het
Brd8	C	A	18: 34,609,949	V288L	probably benign	Het
Carmil2	T	C	8: 105,686,315		probably null	Het
Catspere2	G	A	1: 178,077,482	E153K	possibly damaging	Het
Ccdc162	C	T	10: 41,666,741	R379Q	probably benign	Het
Cdh16	A	G	8: 104,614,504	L116P	probably damaging	Het
Cenpj	A	T	14: 56,558,619	H260Q	possibly damaging	Het
Cenpq	A	G	17: 40,933,136	V17A	possibly damaging	Het
Cep350	T	C	1: 155,928,116	K1074E	probably damaging	Het
Chil4	C	A	3: 106,201,805	C394F	probably damaging	Het
Chst9	T	C	18: 15,717,926	I28V	probably benign	Het
Clasp2	C	A	9: 113,899,581	N873K	probably damaging	Het
Clec4b2	T	A	6: 123,181,310	M45K	probably benign	Het
Cmya5	T	A	13: 93,063,540	T3427S	possibly damaging	Het
Cnih4	A	G	1: 181,162,212	Y130C	probably damaging	Het
Cpne9	T	A	6: 113,304,545	M529K	probably damaging	Het
Ctsr	T	A	13: 61,161,825	Y190F	probably damaging	Het
Cyp2j13	G	A	4: 96,056,916	H351Y	probably benign	Het
Dixdc1	T	A	9: 50,701,965	Q230L	probably damaging	Het
Dpep1	A	T	8: 123,200,025	I226F	probably benign	Het
Ehd2	A	G	7: 15,957,678	V243A	probably benign	Het
Etnk2	T	A	1: 133,378,494	Y353N	probably benign	Het
Fgg	G	T	3: 83,013,015	G367V	probably damaging	Het
Gm11639	A	T	11: 104,914,895	N3076I	unknown	Het
Gm609	T	C	16: 45,443,836	T120A	probably benign	Het
Gm9772	T	C	17: 22,006,329	*61Q	probably null	Het
Grk5	T	G	19: 61,089,994	D496E	possibly damaging	Het
Hc	T	C	2: 35,019,523	N915S	probably benign	Het
Iah1	G	T	12: 21,317,387	Q31H	probably benign	Het
Insr	T	C	8: 3,169,714	D936G	probably benign	Het
Ints6	A	C	14: 62,702,453	V596G	probably benign	Het
Ispd	A	T	12: 36,390,482	N130Y	probably damaging	Het
Kcnj16	A	G	11: 111,024,851	D113G	possibly damaging	Het
Kdm4b	A	T	17: 56,399,771	I928F	probably damaging	Het
Lrrc41	C	T	4: 116,075,291		probably benign	Het
Lrrc8e	G	A	8: 4,235,070	V432I	probably benign	Het
Mamdc4	T	C	2: 25,568,489	E336G	probably benign	Het
Maml2	C	A	9: 13,621,622	Q711K		Het
Map3k14	T	C	11: 103,227,672	T563A	possibly damaging	Het
Mcu	T	A	10: 59,467,713	K101*	probably null	Het
Mettl22	T	A	16: 8,485,928	V286E	probably damaging	Het
Mon2	A	T	10: 123,009,611	N1396K	possibly damaging	Het
Mprip	T	C	11: 59,697,025		probably benign	Het
Mrpl51	C	T	6: 125,193,381	L117F	probably damaging	Het
Myo1d	C	A	11: 80,674,932	V356F	probably damaging	Het
Myo1d	T	A	11: 80,676,932	I241F	probably benign	Het
Naalad2	A	T	9: 18,385,934		probably benign	Het
Nacad	T	C	11: 6,602,853	T113A	probably benign	Het
Nrap	T	A	19: 56,364,411		probably benign	Het
Olfr1134	T	C	2: 87,656,247	I225V	possibly damaging	Het
Olfr1336	T	C	7: 6,460,764	L85P	probably damaging	Het
Olfr1358	G	A	10: 78,520,450	V281M	possibly damaging	Het
Olfr290	T	A	7: 84,916,418	I213N	possibly damaging	Het
Olfr30	T	C	11: 58,455,110	T280A	possibly damaging	Het
Olfr661	T	A	7: 104,688,180	I55N	probably damaging	Het
Osbpl3	T	C	6: 50,351,872	D117G	probably damaging	Het
Parp9	C	T	16: 35,953,611	R318*	probably null	Het
Pcdhb18	A	G	18: 37,490,321	I235V	probably benign	Het
Pex16	T	G	2: 92,379,021		probably benign	Het
Pmepa1	C	A	2: 173,227,835	G271V	probably damaging	Het
Safb	A	G	17: 56,603,579	E659G	unknown	Het
Scn9a	T	C	2: 66,501,666	T1289A	probably damaging	Het
Secisbp2l	T	C	2: 125,775,676	D27G	possibly damaging	Het
Serpina1f	A	G	12: 103,693,981	V14A	probably benign	Het
Serpinb9b	C	A	13: 33,029,469	T3N	possibly damaging	Het
Sfxn5	C	T	6: 85,229,200	M315I	probably benign	Het
Slc9b2	A	G	3: 135,329,769	D333G	probably benign	Het
Sostdc1	A	G	12: 36,317,230	N135S	possibly damaging	Het
Spg11	T	G	2: 122,070,944	D1505A	probably damaging	Het
Taar7a	T	C	10: 23,993,381	N34S	probably benign	Het
Tcerg1l	C	A	7: 138,209,797	R556L	possibly damaging	Het
Tcp11l1	T	C	2: 104,688,418	K311R	probably benign	Het
Tepp	A	T	8: 95,321,255		probably benign	Het
Trbv16	T	G	6: 41,152,038	F52C	probably damaging	Het
Ttn	T	A	2: 76,895,672	R6073S	unknown	Het
Uba1y	T	C	Y: 828,818	I542T	possibly damaging	Het
Vmn1r214	T	C	13: 23,034,912	I192T	probably benign	Het
Vmn2r67	C	T	7: 85,137,138	C553Y	probably damaging	Het
Zdhhc17	G	T	10: 110,948,260	H452N	possibly damaging	Het

Other mutations in Piezo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01360:Piezo2	APN	18	63117699	missense	probably damaging	1.00
IGL01370:Piezo2	APN	18	63022460	missense	probably damaging	1.00
IGL01543:Piezo2	APN	18	63070030	missense	probably damaging	1.00
IGL01561:Piezo2	APN	18	63124614	missense	probably benign	0.03
IGL01568:Piezo2	APN	18	63030392	missense	probably benign	0.28
IGL01653:Piezo2	APN	18	63182833	splice site	probably benign
IGL01674:Piezo2	APN	18	63027559	missense	probably damaging	1.00
IGL01684:Piezo2	APN	18	63083170	missense	probably damaging	1.00
IGL01744:Piezo2	APN	18	63042788	missense	probably damaging	1.00
IGL01859:Piezo2	APN	18	63092844	missense	probably benign	0.10
IGL02183:Piezo2	APN	18	63020634	missense	probably benign	0.00
IGL02407:Piezo2	APN	18	63146844	missense	probably damaging	1.00
IGL02441:Piezo2	APN	18	63072862	missense	probably damaging	1.00
IGL02542:Piezo2	APN	18	63032924	missense	probably damaging	0.96
IGL02652:Piezo2	APN	18	63024475	missense	probably damaging	1.00
IGL02710:Piezo2	APN	18	63074659	missense	probably damaging	1.00
IGL02850:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02851:Piezo2	APN	18	63020633	missense	probably benign	0.18
IGL02972:Piezo2	APN	18	63064785	splice site	probably benign
IGL03011:Piezo2	APN	18	63124660	missense	probably benign	0.03
IGL03078:Piezo2	APN	18	63070075	missense	probably damaging	1.00
IGL03114:Piezo2	APN	18	63030272	splice site	probably null
IGL03129:Piezo2	APN	18	63114972	missense	probably benign
IGL03143:Piezo2	APN	18	63108076	missense	probably damaging	0.99
IGL03202:Piezo2	APN	18	63011598	missense	probably damaging	1.00
IGL03227:Piezo2	APN	18	63124606	missense	probably damaging	1.00
IGL03228:Piezo2	APN	18	63053062	missense	probably damaging	1.00
IGL03230:Piezo2	APN	18	63041720	missense	probably damaging	1.00
IGL03242:Piezo2	APN	18	63011538	utr 3 prime	probably benign
IGL03291:Piezo2	APN	18	63021308	missense	probably damaging	1.00
IGL03301:Piezo2	APN	18	63027704	missense	probably damaging	1.00
Piccolo	UTSW	18	63011696	missense	probably damaging	1.00
sopranino	UTSW	18	63024466	missense	probably damaging	1.00
woodwind	UTSW	18	63124642	missense	possibly damaging	0.50
P0023:Piezo2	UTSW	18	63386200	splice site	probably benign
PIT4802001:Piezo2	UTSW	18	63024469	missense	probably damaging	1.00
R0070:Piezo2	UTSW	18	63102084	missense	probably damaging	1.00
R0416:Piezo2	UTSW	18	63024491	missense	probably damaging	1.00
R0486:Piezo2	UTSW	18	63029061	missense	probably damaging	1.00
R0498:Piezo2	UTSW	18	63102174	missense	possibly damaging	0.87
R0504:Piezo2	UTSW	18	63024451	missense	probably damaging	1.00
R0506:Piezo2	UTSW	18	63027544	missense	probably damaging	1.00
R0523:Piezo2	UTSW	18	63022481	missense	probably damaging	1.00
R0587:Piezo2	UTSW	18	63022426	missense	possibly damaging	0.82
R0626:Piezo2	UTSW	18	63019258	missense	probably damaging	0.97
R0734:Piezo2	UTSW	18	63041723	missense	probably damaging	1.00
R0784:Piezo2	UTSW	18	63083235	missense	probably damaging	1.00
R0973:Piezo2	UTSW	18	63015802	missense	probably damaging	1.00
R1183:Piezo2	UTSW	18	63086753	missense	probably damaging	1.00
R1344:Piezo2	UTSW	18	63021254	missense	probably damaging	1.00
R1474:Piezo2	UTSW	18	63083131	missense	probably damaging	1.00
R1571:Piezo2	UTSW	18	63144919	missense	possibly damaging	0.67
R1643:Piezo2	UTSW	18	63082915	missense	probably benign	0.03
R1649:Piezo2	UTSW	18	63117672	missense	probably benign	0.34
R1741:Piezo2	UTSW	18	63021173	missense	probably damaging	1.00
R1764:Piezo2	UTSW	18	63124642	missense	possibly damaging	0.50
R1793:Piezo2	UTSW	18	63106284	missense	possibly damaging	0.78
R1799:Piezo2	UTSW	18	63032840	critical splice donor site	probably null
R1799:Piezo2	UTSW	18	63108087	missense	probably damaging	1.00
R1868:Piezo2	UTSW	18	63019344	missense	probably damaging	1.00
R1879:Piezo2	UTSW	18	63113960	missense	probably damaging	1.00
R1962:Piezo2	UTSW	18	63078840	missense	probably damaging	0.98
R1990:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1991:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1992:Piezo2	UTSW	18	63074662	missense	probably null	1.00
R1995:Piezo2	UTSW	18	63078781	missense	probably damaging	1.00
R2004:Piezo2	UTSW	18	63144926	missense	probably damaging	1.00
R2011:Piezo2	UTSW	18	63059744	missense	probably damaging	1.00
R2029:Piezo2	UTSW	18	63118935	missense	possibly damaging	0.62
R2075:Piezo2	UTSW	18	63081734	missense	probably damaging	1.00
R2078:Piezo2	UTSW	18	63117720	missense	probably damaging	0.99
R2152:Piezo2	UTSW	18	63114041	missense	probably damaging	1.00
R2162:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R2183:Piezo2	UTSW	18	63106274	missense	probably damaging	1.00
R2230:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2231:Piezo2	UTSW	18	63145072	missense	probably damaging	1.00
R2406:Piezo2	UTSW	18	63022525	missense	probably damaging	1.00
R2431:Piezo2	UTSW	18	63245624	missense	possibly damaging	0.95
R2876:Piezo2	UTSW	18	63053035	missense	probably damaging	1.00
R2935:Piezo2	UTSW	18	63146843	missense	probably damaging	1.00
R3004:Piezo2	UTSW	18	63024435	nonsense	probably null
R3016:Piezo2	UTSW	18	63042832	missense	probably damaging	1.00
R3794:Piezo2	UTSW	18	63081793	missense	probably damaging	0.99
R3832:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3833:Piezo2	UTSW	18	63081662	critical splice donor site	probably null
R3968:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3969:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R3970:Piezo2	UTSW	18	63011696	missense	probably damaging	1.00
R4169:Piezo2	UTSW	18	63050604	missense	probably benign
R4181:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4301:Piezo2	UTSW	18	63084840	missense	probably damaging	1.00
R4302:Piezo2	UTSW	18	63124730	critical splice acceptor site	probably null
R4475:Piezo2	UTSW	18	63102099	missense	probably damaging	1.00
R4493:Piezo2	UTSW	18	63114063	missense	probably damaging	0.98
R4519:Piezo2	UTSW	18	63072880	missense	probably damaging	1.00
R4539:Piezo2	UTSW	18	63086628	missense	probably damaging	1.00
R4687:Piezo2	UTSW	18	63069963	missense	probably damaging	1.00
R4732:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4733:Piezo2	UTSW	18	63030401	missense	probably damaging	1.00
R4825:Piezo2	UTSW	18	63144954	missense	probably damaging	0.98
R4899:Piezo2	UTSW	18	63078791	missense	possibly damaging	0.84
R4946:Piezo2	UTSW	18	63157262	missense	probably benign
R4961:Piezo2	UTSW	18	63052961	splice site	probably null
R4968:Piezo2	UTSW	18	63144971	nonsense	probably null
R4973:Piezo2	UTSW	18	63074680	missense	probably damaging	1.00
R4997:Piezo2	UTSW	18	63083113	missense	probably damaging	1.00
R5078:Piezo2	UTSW	18	63024536	missense	probably damaging	1.00
R5134:Piezo2	UTSW	18	63074620	missense	probably damaging	1.00
R5151:Piezo2	UTSW	18	63030409	missense	possibly damaging	0.72
R5209:Piezo2	UTSW	18	63032929	missense	probably damaging	1.00
R5367:Piezo2	UTSW	18	63064731	missense	probably damaging	1.00
R5401:Piezo2	UTSW	18	63084740	missense	possibly damaging	0.81
R5464:Piezo2	UTSW	18	63145105	missense	probably damaging	1.00
R5469:Piezo2	UTSW	18	63027864	missense	probably damaging	1.00
R5650:Piezo2	UTSW	18	63011721	missense	probably damaging	1.00
R5654:Piezo2	UTSW	18	63145091	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117696	missense	possibly damaging	0.94
R5677:Piezo2	UTSW	18	63117697	missense	probably benign	0.25
R5792:Piezo2	UTSW	18	63146856	missense	probably damaging	1.00
R5874:Piezo2	UTSW	18	63027901	missense	probably damaging	1.00
R5877:Piezo2	UTSW	18	63113934	missense	probably benign	0.22
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6036:Piezo2	UTSW	18	63114948	nonsense	probably null
R6073:Piezo2	UTSW	18	63012645	missense	probably damaging	1.00
R6198:Piezo2	UTSW	18	63157210	nonsense	probably null
R6255:Piezo2	UTSW	18	63121270	missense	possibly damaging	0.75
R6259:Piezo2	UTSW	18	63117678	missense	possibly damaging	0.69
R6391:Piezo2	UTSW	18	63106293	missense	possibly damaging	0.79
R6446:Piezo2	UTSW	18	63086607	missense	probably damaging	1.00
R6465:Piezo2	UTSW	18	63041663	missense	possibly damaging	0.82
R6518:Piezo2	UTSW	18	63106271	missense	probably damaging	0.99
R6521:Piezo2	UTSW	18	63021328	missense	probably damaging	1.00
R6625:Piezo2	UTSW	18	63021262	missense	probably damaging	1.00
R6744:Piezo2	UTSW	18	63032889	nonsense	probably null
R6855:Piezo2	UTSW	18	63090879	critical splice donor site	probably null
R6927:Piezo2	UTSW	18	63032986	missense	probably damaging	1.00
R6980:Piezo2	UTSW	18	63082961	critical splice acceptor site	probably null
R7141:Piezo2	UTSW	18	63145110	nonsense	probably null
R7162:Piezo2	UTSW	18	63124709	missense	possibly damaging	0.50
R7331:Piezo2	UTSW	18	63108030	missense	probably damaging	0.99
R7382:Piezo2	UTSW	18	63017519	splice site	probably null
R7395:Piezo2	UTSW	18	63027563	missense	probably damaging	1.00
R7448:Piezo2	UTSW	18	63024472	missense	probably damaging	1.00
R7465:Piezo2	UTSW	18	63012723	missense	probably benign
R7517:Piezo2	UTSW	18	63082925	missense	possibly damaging	0.52
R7577:Piezo2	UTSW	18	63053010	missense	probably benign	0.01
R7612:Piezo2	UTSW	18	63042539	missense	probably benign	0.12
R7829:Piezo2	UTSW	18	63113876	critical splice donor site	probably null
R7835:Piezo2	UTSW	18	63082945	missense	probably benign	0.12
R8014:Piezo2	UTSW	18	63083200	missense	probably benign	0.02
R8055:Piezo2	UTSW	18	63042811	missense	probably damaging	0.99
R8062:Piezo2	UTSW	18	63030466	missense	possibly damaging	0.87
R8306:Piezo2	UTSW	18	63075730	missense	probably damaging	1.00
R8332:Piezo2	UTSW	18	63012786	missense	possibly damaging	0.67
R8355:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8383:Piezo2	UTSW	18	63084688	missense	probably damaging	0.97
R8455:Piezo2	UTSW	18	63090998	missense	probably damaging	1.00
R8501:Piezo2	UTSW	18	63045540	missense	probably damaging	0.99
R8523:Piezo2	UTSW	18	63146802	missense	probably damaging	0.99
R8692:Piezo2	UTSW	18	63092900	nonsense	probably null
R8708:Piezo2	UTSW	18	63093015	missense	probably damaging	1.00
R8726:Piezo2	UTSW	18	63109885	missense	probably benign
R8727:Piezo2	UTSW	18	63109885	missense	probably benign
R8900:Piezo2	UTSW	18	63115025	missense	probably benign	0.04
R9037:Piezo2	UTSW	18	63092831	missense	probably benign	0.31
R9079:Piezo2	UTSW	18	63024466	missense	probably damaging	1.00
R9090:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9090:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9123:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9125:Piezo2	UTSW	18	63045518	missense	probably benign	0.00
R9171:Piezo2	UTSW	18	63045479	missense	probably benign	0.04
R9194:Piezo2	UTSW	18	63117744	missense	probably benign	0.03
R9203:Piezo2	UTSW	18	63157231	missense	probably benign	0.00
R9209:Piezo2	UTSW	18	63021301	missense	probably damaging	1.00
R9261:Piezo2	UTSW	18	63075797	missense	possibly damaging	0.84
R9271:Piezo2	UTSW	18	63030379	missense	probably damaging	0.99
R9271:Piezo2	UTSW	18	63075719	missense	probably damaging	0.99
R9283:Piezo2	UTSW	18	63024566	missense	probably damaging	1.00
R9377:Piezo2	UTSW	18	63029085	missense	possibly damaging	0.48
R9499:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9531:Piezo2	UTSW	18	63102165	missense	possibly damaging	0.95
R9551:Piezo2	UTSW	18	63032962	missense	possibly damaging	0.67
R9607:Piezo2	UTSW	18	63386276	start gained	probably benign
R9608:Piezo2	UTSW	18	63146945	missense	probably benign	0.09
R9617:Piezo2	UTSW	18	63115037	missense	probably benign	0.43
R9624:Piezo2	UTSW	18	63064696	missense	possibly damaging	0.88
X0017:Piezo2	UTSW	18	63027586	missense	probably damaging	0.99
X0022:Piezo2	UTSW	18	63050610	missense	probably benign	0.43
X0060:Piezo2	UTSW	18	63017577	missense	probably benign	0.09
Z1088:Piezo2	UTSW	18	63069994	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCCTGTGGTCCCTTGTGAAC -3'
(R):5'- GTTGGAGCCACTTCCTATACC -3'

Sequencing Primer
(F):5'- TGTGAACAGGCCCTTTGATATC -3'
(R):5'- GTTGGAGCCACTTCCTATACCAGAAG -3'

Posted On

2021-04-30