Incidental Mutation 'R8811:Phkb'
ID 672411
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Name phosphorylase kinase beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock # R8811 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 85840959-86061376 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86018527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 611 (V611A)
Ref Sequence ENSEMBL: ENSMUSP00000050788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771]
AlphaFold Q7TSH2
Predicted Effect possibly damaging
Transcript: ENSMUST00000053771
AA Change: V611A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879
AA Change: V611A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125051
Gene: ENSMUSG00000036879
AA Change: V41A

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 26 301 2.2e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T G 17: 24,317,238 K485T probably benign Het
Abcc12 G T 8: 86,553,394 L337M probably damaging Het
Adcy4 T C 14: 55,772,764 D687G probably benign Het
Aldoc T A 11: 78,324,784 I98N probably damaging Het
Aoah T A 13: 20,999,951 V395D probably damaging Het
Arap1 C T 7: 101,387,196 R397W probably damaging Het
Arl16 A T 11: 120,466,700 M63K probably damaging Het
Atf7 T C 15: 102,593,709 D4G probably damaging Het
Atp6v0d2 A T 4: 19,922,397 V34D probably benign Het
Camk1g C G 1: 193,362,100 G2A probably damaging Het
Cenpe A G 3: 135,223,240 T302A probably damaging Het
Cps1 T C 1: 67,214,087 V1246A probably benign Het
Csmd3 T C 15: 47,696,743 D1397G Het
Ddx39b T A 17: 35,244,459 S115T probably benign Het
Dnaja3 C A 16: 4,696,519 T305K probably benign Het
Dusp7 C G 9: 106,371,042 H290D probably benign Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Erbin C T 13: 103,886,316 R5Q probably damaging Het
Fam26d T A 10: 34,041,665 K263N probably benign Het
Fam3b T C 16: 97,512,515 probably benign Het
Foxn3 T C 12: 99,196,692 S317G probably benign Het
Gipc1 T A 8: 83,662,290 M177K possibly damaging Het
Grpel2 A C 18: 61,718,752 probably benign Het
Htr1a G C 13: 105,444,593 A114P probably damaging Het
Iqch A T 9: 63,544,913 M210K possibly damaging Het
Kdelr3 T C 15: 79,525,851 I179T possibly damaging Het
Lat2 C T 5: 134,606,699 probably benign Het
Mcrip1 A G 11: 120,544,779 V10A probably damaging Het
Mib1 C T 18: 10,755,643 L350F probably benign Het
Nhlrc2 T A 19: 56,594,912 V605E probably benign Het
Nup133 AAGAGA AAGA 8: 123,911,888 900 probably null Het
Nutm2 A T 13: 50,469,953 I229F probably benign Het
Olfr308 G A 7: 86,321,781 T57M probably damaging Het
Polg2 A T 11: 106,779,382 Y21N probably benign Het
Prss28 T A 17: 25,309,653 I23N probably benign Het
Ptprz1 G A 6: 23,030,662 V1856I probably benign Het
Slc22a22 A T 15: 57,244,841 I526N probably damaging Het
Slc24a4 T C 12: 102,213,874 F68S probably damaging Het
Slc37a3 A G 6: 39,345,340 S377P probably damaging Het
Smoc2 T C 17: 14,325,634 S62P probably damaging Het
Sox4 A G 13: 28,952,928 S32P probably damaging Het
Stxbp2 A T 8: 3,639,541 Q426L Het
Synrg T G 11: 84,019,584 S937A probably benign Het
Tbr1 C A 2: 61,811,852 T487K possibly damaging Het
Tll2 T C 19: 41,206,573 T25A probably benign Het
Trim31 T C 17: 36,899,983 F169S probably benign Het
Tro G A X: 150,655,559 S34L unknown Het
Tspear T C 10: 77,829,629 F83S probably benign Het
Ubr5 C A 15: 38,040,879 A254S Het
Ubtfl1 A G 9: 18,410,163 E329G probably benign Het
Vmn2r45 A G 7: 8,471,882 W716R probably damaging Het
Vmn2r67 T C 7: 85,150,687 M448V probably damaging Het
Wwc2 T G 8: 47,883,544 I228L possibly damaging Het
Zbtb20 T C 16: 43,610,494 V383A probably benign Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 85957587 missense probably benign 0.42
IGL01126:Phkb APN 8 85946101 missense probably benign 0.12
IGL01700:Phkb APN 8 86017465 missense probably benign 0.06
IGL01761:Phkb APN 8 86019064 missense probably benign 0.01
IGL02404:Phkb APN 8 85878115 missense possibly damaging 0.94
IGL02672:Phkb APN 8 85942358 missense probably benign
IGL02682:Phkb APN 8 85875646 makesense probably null
IGL02693:Phkb APN 8 85942234 missense probably damaging 1.00
IGL02798:Phkb APN 8 86043777 missense probably benign
IGL02888:Phkb APN 8 85935472 critical splice donor site probably null
IGL03106:Phkb APN 8 86018466 splice site probably benign
PIT4544001:Phkb UTSW 8 86011637 missense probably benign 0.42
R0088:Phkb UTSW 8 85942391 critical splice donor site probably null
R0107:Phkb UTSW 8 86016931 missense probably benign 0.01
R0504:Phkb UTSW 8 86056524 missense probably benign
R0569:Phkb UTSW 8 86017402 missense probably damaging 1.00
R0671:Phkb UTSW 8 85875693 missense probably damaging 0.97
R0894:Phkb UTSW 8 86017441 missense probably damaging 1.00
R1491:Phkb UTSW 8 85875657 missense possibly damaging 0.90
R1502:Phkb UTSW 8 86059339 missense possibly damaging 0.69
R1595:Phkb UTSW 8 86026553 splice site probably benign
R1686:Phkb UTSW 8 86021649 missense probably benign
R1913:Phkb UTSW 8 85901920 missense possibly damaging 0.95
R1919:Phkb UTSW 8 85922161 missense probably benign 0.17
R1968:Phkb UTSW 8 85970951 missense probably benign 0.07
R2008:Phkb UTSW 8 86056467 missense probably damaging 1.00
R2051:Phkb UTSW 8 86049821 critical splice donor site probably null
R2148:Phkb UTSW 8 86017486 missense probably damaging 0.96
R2305:Phkb UTSW 8 86043802 missense possibly damaging 0.80
R3801:Phkb UTSW 8 85922229 nonsense probably null
R3804:Phkb UTSW 8 85922229 nonsense probably null
R4159:Phkb UTSW 8 86021533 splice site probably null
R4624:Phkb UTSW 8 85848712 intron probably benign
R4833:Phkb UTSW 8 85901911 missense probably damaging 1.00
R5017:Phkb UTSW 8 86049809 missense probably benign
R5169:Phkb UTSW 8 85896491 missense probably benign 0.01
R5337:Phkb UTSW 8 85878245 missense probably damaging 1.00
R5391:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5395:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5480:Phkb UTSW 8 85922182 missense probably damaging 1.00
R5538:Phkb UTSW 8 85922127 missense possibly damaging 0.80
R5623:Phkb UTSW 8 85843048 unclassified probably benign
R5753:Phkb UTSW 8 85878230 missense probably damaging 1.00
R5909:Phkb UTSW 8 86021447 critical splice donor site probably null
R5929:Phkb UTSW 8 85970914 missense probably benign 0.01
R6093:Phkb UTSW 8 85942329 missense probably damaging 1.00
R6320:Phkb UTSW 8 85875698 missense probably benign 0.00
R6324:Phkb UTSW 8 86018542 missense probably benign 0.00
R6626:Phkb UTSW 8 85922151 missense probably damaging 0.96
R6687:Phkb UTSW 8 86029546 missense probably damaging 1.00
R6848:Phkb UTSW 8 86029617 missense probably damaging 0.99
R7228:Phkb UTSW 8 85843007 unclassified probably benign
R7260:Phkb UTSW 8 85878130 missense probably benign 0.07
R7271:Phkb UTSW 8 86043789 missense probably damaging 1.00
R7314:Phkb UTSW 8 85942392 splice site probably null
R7586:Phkb UTSW 8 86029597 missense probably damaging 1.00
R7654:Phkb UTSW 8 85940887 missense possibly damaging 0.91
R7958:Phkb UTSW 8 86021663 missense probably benign 0.00
R8269:Phkb UTSW 8 86029582 missense probably benign 0.42
R8967:Phkb UTSW 8 86029434 intron probably benign
R9176:Phkb UTSW 8 85970994 missense probably damaging 0.96
R9350:Phkb UTSW 8 86016864 nonsense probably null
R9465:Phkb UTSW 8 85896430 missense probably damaging 1.00
X0021:Phkb UTSW 8 86029635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGCCTAAATTACCCAGAGTTTG -3'
(R):5'- GGCTCAGCCTTCAAGTTTTCTG -3'

Sequencing Primer
(F):5'- CCTCTCAGTTAAGGATCCCA -3'
(R):5'- TCCATAGGTGAGCATGGGATCC -3'
Posted On 2021-04-30