Incidental Mutation 'R8811:Nup133'
ID672413
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8811 (G1)
Quality Score217.468
Status Not validated
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAGAGA to AAGA at 123911888 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect probably null
Transcript: ENSMUST00000044795
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T G 17: 24,317,238 K485T probably benign Het
Abcc12 G T 8: 86,553,394 L337M probably damaging Het
Adcy4 T C 14: 55,772,764 D687G probably benign Het
Aldoc T A 11: 78,324,784 I98N probably damaging Het
Aoah T A 13: 20,999,951 V395D probably damaging Het
Arap1 C T 7: 101,387,196 R397W probably damaging Het
Arl16 A T 11: 120,466,700 M63K probably damaging Het
Atf7 T C 15: 102,593,709 D4G probably damaging Het
Atp6v0d2 A T 4: 19,922,397 V34D probably benign Het
Camk1g C G 1: 193,362,100 G2A probably damaging Het
Cenpe A G 3: 135,223,240 T302A probably damaging Het
Cps1 T C 1: 67,214,087 V1246A probably benign Het
Csmd3 T C 15: 47,696,743 D1397G Het
Ddx39b T A 17: 35,244,459 S115T probably benign Het
Dnaja3 C A 16: 4,696,519 T305K probably benign Het
Dusp7 C G 9: 106,371,042 H290D probably benign Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Erbin C T 13: 103,886,316 R5Q probably damaging Het
Fam26d T A 10: 34,041,665 K263N probably benign Het
Fam3b T C 16: 97,512,515 probably benign Het
Foxn3 T C 12: 99,196,692 S317G probably benign Het
Gipc1 T A 8: 83,662,290 M177K possibly damaging Het
Grpel2 A C 18: 61,718,752 probably benign Het
Htr1a G C 13: 105,444,593 A114P probably damaging Het
Iqch A T 9: 63,544,913 M210K possibly damaging Het
Kdelr3 T C 15: 79,525,851 I179T possibly damaging Het
Mcrip1 A G 11: 120,544,779 V10A probably damaging Het
Mib1 C T 18: 10,755,643 L350F probably benign Het
Nhlrc2 T A 19: 56,594,912 V605E probably benign Het
Nutm2 A T 13: 50,469,953 I229F probably benign Het
Olfr308 G A 7: 86,321,781 T57M probably damaging Het
Phkb T C 8: 86,018,527 V611A possibly damaging Het
Polg2 A T 11: 106,779,382 Y21N probably benign Het
Prss28 T A 17: 25,309,653 I23N probably benign Het
Ptprz1 G A 6: 23,030,662 V1856I probably benign Het
Slc22a22 A T 15: 57,244,841 I526N probably damaging Het
Slc24a4 T C 12: 102,213,874 F68S probably damaging Het
Slc37a3 A G 6: 39,345,340 S377P probably damaging Het
Smoc2 T C 17: 14,325,634 S62P probably damaging Het
Sox4 A G 13: 28,952,928 S32P probably damaging Het
Stxbp2 A T 8: 3,639,541 Q426L Het
Synrg T G 11: 84,019,584 S937A probably benign Het
Tbr1 C A 2: 61,811,852 T487K possibly damaging Het
Tll2 T C 19: 41,206,573 T25A probably benign Het
Trim31 T C 17: 36,899,983 F169S probably benign Het
Tro G A X: 150,655,559 S34L unknown Het
Tspear T C 10: 77,829,629 F83S probably benign Het
Ubr5 C A 15: 38,040,879 A254S Het
Ubtfl1 A G 9: 18,410,163 E329G probably benign Het
Vmn2r45 A G 7: 8,471,882 W716R probably damaging Het
Vmn2r67 T C 7: 85,150,687 M448V probably damaging Het
Wwc2 T G 8: 47,883,544 I228L possibly damaging Het
Zbtb20 T C 16: 43,610,494 V383A probably benign Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R7501:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
R8397:Nup133 UTSW 8 123922417 missense probably benign 0.17
R8703:Nup133 UTSW 8 123916282 critical splice donor site probably null
R8813:Nup133 UTSW 8 123911888 frame shift probably null
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTAACCAGCTGCTTCTCGTAAG -3'
(R):5'- AACTGCAAGGTGGCTTAGC -3'

Sequencing Primer
(F):5'- TCGTAAGCAAACCATCTTACCTTC -3'
(R):5'- GACCTGAGTCAGATTCTAGAGCCTC -3'
Posted On2021-04-30