Incidental Mutation 'K3955:Lars2'
ID67242
Institutional Source Beutler Lab
Gene Symbol Lars2
Ensembl Gene ENSMUSG00000035202
Gene Nameleucyl-tRNA synthetase, mitochondrial
SynonymsKiaa0028
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #K3955 (G3) of strain 706
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123366927-123462666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123377777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000150083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000216843] [ENSMUST00000217116]
Predicted Effect probably damaging
Transcript: ENSMUST00000038863
AA Change: V103A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: V103A

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 57 223 7.6e-24 PFAM
Pfam:tRNA-synt_1g 83 239 9.3e-20 PFAM
Pfam:tRNA-synt_1_2 269 430 1.1e-8 PFAM
Pfam:tRNA-synt_1 434 609 5.6e-8 PFAM
Pfam:tRNA-synt_1g 589 682 1.2e-6 PFAM
Pfam:tRNA-synt_1 633 678 1.6e-7 PFAM
Pfam:Anticodon_1 724 867 9.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214074
Predicted Effect unknown
Transcript: ENSMUST00000215464
AA Change: V14A
Predicted Effect probably benign
Transcript: ENSMUST00000216843
Predicted Effect probably damaging
Transcript: ENSMUST00000217116
AA Change: V103A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7054 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 G A 1: 89,887,604 R738H probably damaging Het
Arhgap28 T C 17: 68,004,006 E2G probably damaging Het
Atad2b C A 12: 4,954,536 probably benign Het
Atmin T A 8: 116,957,036 C478* probably null Het
Calr T C 8: 84,846,273 Y57C probably damaging Het
Cdh13 G A 8: 118,675,104 V82M probably damaging Het
Ces3a A T 8: 105,050,627 probably benign Het
Dmbt1 T C 7: 131,119,564 Y1854H probably damaging Het
Dnah1 T A 14: 31,266,459 M3429L probably benign Het
Dscam A G 16: 96,673,687 F1225S probably benign Het
E030025P04Rik G A 11: 109,143,952 P37S unknown Het
Eral1 A T 11: 78,076,021 D189E probably damaging Het
Fbxw14 G T 9: 109,276,245 P284Q possibly damaging Het
Fcrl6 A G 1: 172,597,684 V260A probably benign Het
Fezf2 A T 14: 12,345,097 F30Y probably damaging Het
Gjb4 A T 4: 127,351,500 V216D probably benign Het
Gm13023 T C 4: 143,795,140 I442T possibly damaging Het
Gm9758 G A 5: 14,913,508 probably benign Het
Gm9758 C G 5: 14,913,539 V92L probably benign Het
Gmps A C 3: 64,001,533 R485S probably damaging Het
Gtdc1 C T 2: 44,752,221 probably null Het
H2-Ob C T 17: 34,241,184 R19C probably damaging Het
Ndnf G A 6: 65,701,429 probably benign Het
Nectin1 A G 9: 43,792,078 Y211C probably damaging Het
Notch4 C T 17: 34,568,462 T332I probably damaging Het
Olfr272 A G 4: 52,911,081 F238L probably damaging Het
Olfr945 A C 9: 39,258,630 L14W probably damaging Het
Olfr968 A G 9: 39,772,173 I209T probably benign Het
Paf1 T C 7: 28,396,925 probably null Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Prkcq T C 2: 11,246,793 probably benign Het
Proser3 G T 7: 30,543,499 P218T probably damaging Het
Rccd1 G A 7: 80,320,671 S66F probably benign Het
Recql G T 6: 142,378,206 S54* probably null Het
Samd15 G T 12: 87,200,760 G73V probably benign Het
Siglec1 T C 2: 131,081,439 N462S probably benign Het
Skiv2l2 A C 13: 112,910,979 Y277* probably null Het
Syne2 G T 12: 75,930,665 A1296S probably damaging Het
Tlk1 T C 2: 70,721,701 E542G possibly damaging Het
Tnks1bp1 C T 2: 85,062,411 T232I probably benign Het
Tnrc6c T A 11: 117,760,738 Y1696N probably damaging Het
Uggt1 A G 1: 36,162,353 I1102T probably benign Het
Vmn1r84 C T 7: 12,361,957 V270M probably damaging Het
Wasf1 C T 10: 40,936,195 P327S unknown Het
Other mutations in Lars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Lars2 APN 9 123453248 missense probably damaging 0.98
IGL01993:Lars2 APN 9 123394943 splice site probably benign
IGL02155:Lars2 APN 9 123454982 missense probably damaging 0.99
IGL02941:Lars2 APN 9 123459585 missense probably damaging 0.97
IGL03090:Lars2 APN 9 123455960 missense probably damaging 1.00
IGL03271:Lars2 APN 9 123459484 splice site probably null
IGL03386:Lars2 APN 9 123453390 nonsense probably null
IGL03410:Lars2 APN 9 123418776 missense possibly damaging 0.87
ulrich UTSW 9 123418693 missense probably damaging 0.99
P0038:Lars2 UTSW 9 123377777 missense probably damaging 1.00
R0276:Lars2 UTSW 9 123438121 splice site probably benign
R1671:Lars2 UTSW 9 123418279 missense probably benign 0.02
R1829:Lars2 UTSW 9 123431917 missense probably benign 0.00
R2219:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R2220:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R4610:Lars2 UTSW 9 123418693 missense probably damaging 0.99
R5027:Lars2 UTSW 9 123441495 missense probably benign 0.38
R5195:Lars2 UTSW 9 123453310 missense probably damaging 0.97
R5597:Lars2 UTSW 9 123454982 missense probably damaging 0.99
R5756:Lars2 UTSW 9 123438199 missense probably damaging 1.00
R5783:Lars2 UTSW 9 123461596 missense probably benign
R6045:Lars2 UTSW 9 123371988 missense probably damaging 1.00
R6235:Lars2 UTSW 9 123411880 missense probably damaging 1.00
R6323:Lars2 UTSW 9 123441594 nonsense probably null
R6377:Lars2 UTSW 9 123454760 missense probably benign 0.00
R6395:Lars2 UTSW 9 123371925 missense probably benign 0.06
R7094:Lars2 UTSW 9 123459585 missense probably damaging 0.99
R7144:Lars2 UTSW 9 123431993 missense probably damaging 1.00
R7233:Lars2 UTSW 9 123411954 nonsense probably null
R7254:Lars2 UTSW 9 123454963 missense possibly damaging 0.93
R7350:Lars2 UTSW 9 123427480 missense probably damaging 1.00
R7413:Lars2 UTSW 9 123459503 missense probably benign 0.30
R7614:Lars2 UTSW 9 123395111 missense
R7683:Lars2 UTSW 9 123377830 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCATTGGATCTCATGTGGATGCAG -3'
(R):5'- AACTGAGCTGGTCATGCTCACAC -3'

Sequencing Primer
(F):5'- GCTTGTCTGGAAAAACAGTCC -3'
(R):5'- TGGTCATGCTCACACTTAAGG -3'
Posted On2013-09-03