Mutagenetix > Incidental Mutation

Incidental Mutation 'K3955:Lars2'

67242

Institutional Source

Beutler Lab

Gene Symbol

Lars2

Ensembl Gene

ENSMUSG00000035202

Gene Name

leucyl-tRNA synthetase, mitochondrial

Synonyms

Kiaa0028

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

K3955 (G3) of strain 706

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123366927-123462666 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123377777 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 103 (V103A)

Ref Sequence

ENSEMBL: ENSMUSP00000150083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000216843] [ENSMUST00000217116]

AlphaFold

Q8VDC0

Predicted Effect

probably damaging
Transcript: ENSMUST00000038863
AA Change: V103A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202
AA Change: V103A

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_1	57	223	7.6e-24	PFAM
Pfam:tRNA-synt_1g	83	239	9.3e-20	PFAM
Pfam:tRNA-synt_1_2	269	430	1.1e-8	PFAM
Pfam:tRNA-synt_1	434	609	5.6e-8	PFAM
Pfam:tRNA-synt_1g	589	682	1.2e-6	PFAM
Pfam:tRNA-synt_1	633	678	1.6e-7	PFAM
Pfam:Anticodon_1	724	867	9.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214074

Predicted Effect

unknown
Transcript: ENSMUST00000215464
AA Change: V14A

Predicted Effect

probably benign
Transcript: ENSMUST00000216843

Predicted Effect

probably damaging
Transcript: ENSMUST00000217116
AA Change: V103A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7054

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	G	A	1: 89,887,604	R738H	probably damaging	Het
Arhgap28	T	C	17: 68,004,006	E2G	probably damaging	Het
Atad2b	C	A	12: 4,954,536		probably benign	Het
Atmin	T	A	8: 116,957,036	C478*	probably null	Het
Calr	T	C	8: 84,846,273	Y57C	probably damaging	Het
Cdh13	G	A	8: 118,675,104	V82M	probably damaging	Het
Ces3a	A	T	8: 105,050,627		probably benign	Het
Dmbt1	T	C	7: 131,119,564	Y1854H	probably damaging	Het
Dnah1	T	A	14: 31,266,459	M3429L	probably benign	Het
Dscam	A	G	16: 96,673,687	F1225S	probably benign	Het
E030025P04Rik	G	A	11: 109,143,952	P37S	unknown	Het
Eral1	A	T	11: 78,076,021	D189E	probably damaging	Het
Fbxw14	G	T	9: 109,276,245	P284Q	possibly damaging	Het
Fcrl6	A	G	1: 172,597,684	V260A	probably benign	Het
Fezf2	A	T	14: 12,345,097	F30Y	probably damaging	Het
Gjb4	A	T	4: 127,351,500	V216D	probably benign	Het
Gm13023	T	C	4: 143,795,140	I442T	possibly damaging	Het
Gm9758	G	A	5: 14,913,508		probably benign	Het
Gm9758	C	G	5: 14,913,539	V92L	probably benign	Het
Gmps	A	C	3: 64,001,533	R485S	probably damaging	Het
Gtdc1	C	T	2: 44,752,221		probably null	Het
H2-Ob	C	T	17: 34,241,184	R19C	probably damaging	Het
Ndnf	G	A	6: 65,701,429		probably benign	Het
Nectin1	A	G	9: 43,792,078	Y211C	probably damaging	Het
Notch4	C	T	17: 34,568,462	T332I	probably damaging	Het
Olfr272	A	G	4: 52,911,081	F238L	probably damaging	Het
Olfr945	A	C	9: 39,258,630	L14W	probably damaging	Het
Olfr968	A	G	9: 39,772,173	I209T	probably benign	Het
Paf1	T	C	7: 28,396,925		probably null	Het
Pcdhb1	G	T	18: 37,265,973	G326C	probably damaging	Het
Plcl1	A	G	1: 55,697,939	Y813C	possibly damaging	Het
Prkcq	T	C	2: 11,246,793		probably benign	Het
Proser3	G	T	7: 30,543,499	P218T	probably damaging	Het
Rccd1	G	A	7: 80,320,671	S66F	probably benign	Het
Recql	G	T	6: 142,378,206	S54*	probably null	Het
Samd15	G	T	12: 87,200,760	G73V	probably benign	Het
Siglec1	T	C	2: 131,081,439	N462S	probably benign	Het
Skiv2l2	A	C	13: 112,910,979	Y277*	probably null	Het
Syne2	G	T	12: 75,930,665	A1296S	probably damaging	Het
Tlk1	T	C	2: 70,721,701	E542G	possibly damaging	Het
Tnks1bp1	C	T	2: 85,062,411	T232I	probably benign	Het
Tnrc6c	T	A	11: 117,760,738	Y1696N	probably damaging	Het
Uggt1	A	G	1: 36,162,353	I1102T	probably benign	Het
Vmn1r84	C	T	7: 12,361,957	V270M	probably damaging	Het
Wasf1	C	T	10: 40,936,195	P327S	unknown	Het

Other mutations in Lars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01743:Lars2	APN	9	123453248	missense	probably damaging	0.98
IGL01993:Lars2	APN	9	123394943	splice site	probably benign
IGL02155:Lars2	APN	9	123454982	missense	probably damaging	0.99
IGL02941:Lars2	APN	9	123459585	missense	probably damaging	0.97
IGL03090:Lars2	APN	9	123455960	missense	probably damaging	1.00
IGL03271:Lars2	APN	9	123459484	splice site	probably null
IGL03386:Lars2	APN	9	123453390	nonsense	probably null
IGL03410:Lars2	APN	9	123418776	missense	possibly damaging	0.87
ulrich	UTSW	9	123418693	missense	probably damaging	0.99
P0038:Lars2	UTSW	9	123377777	missense	probably damaging	1.00
R0276:Lars2	UTSW	9	123438121	splice site	probably benign
R1671:Lars2	UTSW	9	123418279	missense	probably benign	0.02
R1829:Lars2	UTSW	9	123431917	missense	probably benign	0.00
R2219:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R2220:Lars2	UTSW	9	123418780	missense	probably damaging	0.98
R4610:Lars2	UTSW	9	123418693	missense	probably damaging	0.99
R5027:Lars2	UTSW	9	123441495	missense	probably benign	0.38
R5195:Lars2	UTSW	9	123453310	missense	probably damaging	0.97
R5597:Lars2	UTSW	9	123454982	missense	probably damaging	0.99
R5756:Lars2	UTSW	9	123438199	missense	probably damaging	1.00
R5783:Lars2	UTSW	9	123461596	missense	probably benign
R6045:Lars2	UTSW	9	123371988	missense	probably damaging	1.00
R6235:Lars2	UTSW	9	123411880	missense	probably damaging	1.00
R6323:Lars2	UTSW	9	123441594	nonsense	probably null
R6377:Lars2	UTSW	9	123454760	missense	probably benign	0.00
R6395:Lars2	UTSW	9	123371925	missense	probably benign	0.06
R7094:Lars2	UTSW	9	123459585	missense	probably damaging	0.99
R7144:Lars2	UTSW	9	123431993	missense	probably damaging	1.00
R7233:Lars2	UTSW	9	123411954	nonsense	probably null
R7254:Lars2	UTSW	9	123454963	missense	possibly damaging	0.93
R7350:Lars2	UTSW	9	123427480	missense	probably damaging	1.00
R7413:Lars2	UTSW	9	123459503	missense	probably benign	0.30
R7614:Lars2	UTSW	9	123395111	missense
R7683:Lars2	UTSW	9	123377830	critical splice donor site	probably null
R8000:Lars2	UTSW	9	123436244	missense	probably damaging	1.00
R8061:Lars2	UTSW	9	123459497	missense	probably benign
R8355:Lars2	UTSW	9	123454715	missense	probably damaging	1.00
R8364:Lars2	UTSW	9	123411954	nonsense	probably null
R8818:Lars2	UTSW	9	123392827	missense	possibly damaging	0.94
R9007:Lars2	UTSW	9	123431915	nonsense	probably null
R9351:Lars2	UTSW	9	123436301	missense	probably benign	0.38
Z1177:Lars2	UTSW	9	123454782	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCATTGGATCTCATGTGGATGCAG -3'
(R):5'- AACTGAGCTGGTCATGCTCACAC -3'

Sequencing Primer
(F):5'- GCTTGTCTGGAAAAACAGTCC -3'
(R):5'- TGGTCATGCTCACACTTAAGG -3'

Posted On

2013-09-03