Incidental Mutation 'R8811:Smoc2'
ID 672440
Institutional Source Beutler Lab
Gene Symbol Smoc2
Ensembl Gene ENSMUSG00000023886
Gene Name SPARC related modular calcium binding 2
Synonyms 5430426J21Rik, 1700056C05Rik, Smoc2l
MMRRC Submission 068646-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8811 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 14499768-14625052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14545896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 62 (S62P)
Ref Sequence ENSEMBL: ENSMUSP00000024660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024660]
AlphaFold Q8CD91
Predicted Effect probably damaging
Transcript: ENSMUST00000024660
AA Change: S62P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024660
Gene: ENSMUSG00000023886
AA Change: S62P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 39 84 1.49e-12 SMART
TY 110 157 3.07e-14 SMART
low complexity region 166 177 N/A INTRINSIC
TY 237 285 3.34e-15 SMART
Pfam:SPARC_Ca_bdg 302 412 8.6e-13 PFAM
Meta Mutation Damage Score 0.9265 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPARC family (secreted protein acidic and rich in cysteine/osteonectin/BM-40), which are highly expressed during embryogenesis and wound healing. The gene product is a matricellular protein which promotes matrix assembly and can stimulate endothelial cell proliferation and migration, as well as angiogenic activity. Associated with pulmonary function, this secretory gene product contains a Kazal domain, two thymoglobulin type-1 domains, and two EF-hand calcium-binding domains. The encoded protein may serve as a target for controlling angiogenesis in tumor growth and myocardial ischemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for one KO allele exhibit protection from induced kidney fibrosis and reduced interstitial myofibroblast accumulation. Another KO allele leads to shortening and widening of the skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T G 17: 24,536,212 (GRCm39) K485T probably benign Het
Abcc12 G T 8: 87,280,023 (GRCm39) L337M probably damaging Het
Adcy4 T C 14: 56,010,221 (GRCm39) D687G probably benign Het
Aldoc T A 11: 78,215,610 (GRCm39) I98N probably damaging Het
Aoah T A 13: 21,184,121 (GRCm39) V395D probably damaging Het
Arap1 C T 7: 101,036,403 (GRCm39) R397W probably damaging Het
Arl16 A T 11: 120,357,526 (GRCm39) M63K probably damaging Het
Atf7 T C 15: 102,502,144 (GRCm39) D4G probably damaging Het
Atp6v0d2 A T 4: 19,922,397 (GRCm39) V34D probably benign Het
Calhm4 T A 10: 33,917,661 (GRCm39) K263N probably benign Het
Camk1g C G 1: 193,044,408 (GRCm39) G2A probably damaging Het
Cenpe A G 3: 134,929,001 (GRCm39) T302A probably damaging Het
Cps1 T C 1: 67,253,246 (GRCm39) V1246A probably benign Het
Csmd3 T C 15: 47,560,139 (GRCm39) D1397G Het
Ddx39b T A 17: 35,463,435 (GRCm39) S115T probably benign Het
Dnaja3 C A 16: 4,514,383 (GRCm39) T305K probably benign Het
Dusp7 C G 9: 106,248,241 (GRCm39) H290D probably benign Het
Emilin2 T A 17: 71,582,282 (GRCm39) D148V possibly damaging Het
Erbin C T 13: 104,022,824 (GRCm39) R5Q probably damaging Het
Fam3b T C 16: 97,313,715 (GRCm39) probably benign Het
Foxn3 T C 12: 99,162,951 (GRCm39) S317G probably benign Het
Gipc1 T A 8: 84,388,919 (GRCm39) M177K possibly damaging Het
Grpel2 A C 18: 61,851,823 (GRCm39) probably benign Het
Htr1a G C 13: 105,581,101 (GRCm39) A114P probably damaging Het
Iqch A T 9: 63,452,195 (GRCm39) M210K possibly damaging Het
Kdelr3 T C 15: 79,410,052 (GRCm39) I179T possibly damaging Het
Lat2 C T 5: 134,635,553 (GRCm39) probably benign Het
Mcrip1 A G 11: 120,435,605 (GRCm39) V10A probably damaging Het
Mib1 C T 18: 10,755,643 (GRCm39) L350F probably benign Het
Nhlrc2 T A 19: 56,583,344 (GRCm39) V605E probably benign Het
Nup133 AAGAGA AAGA 8: 124,638,627 (GRCm39) 900 probably null Het
Nutm2 A T 13: 50,623,989 (GRCm39) I229F probably benign Het
Or6f1 G A 7: 85,970,989 (GRCm39) T57M probably damaging Het
Phkb T C 8: 86,745,156 (GRCm39) V611A possibly damaging Het
Polg2 A T 11: 106,670,208 (GRCm39) Y21N probably benign Het
Prss28 T A 17: 25,528,627 (GRCm39) I23N probably benign Het
Ptprz1 G A 6: 23,030,661 (GRCm39) V1856I probably benign Het
Slc22a22 A T 15: 57,108,237 (GRCm39) I526N probably damaging Het
Slc24a4 T C 12: 102,180,133 (GRCm39) F68S probably damaging Het
Slc37a3 A G 6: 39,322,274 (GRCm39) S377P probably damaging Het
Sox4 A G 13: 29,136,911 (GRCm39) S32P probably damaging Het
Stxbp2 A T 8: 3,689,541 (GRCm39) Q426L Het
Synrg T G 11: 83,910,410 (GRCm39) S937A probably benign Het
Tbr1 C A 2: 61,642,196 (GRCm39) T487K possibly damaging Het
Tll2 T C 19: 41,195,012 (GRCm39) T25A probably benign Het
Trim31 T C 17: 37,210,875 (GRCm39) F169S probably benign Het
Tro G A X: 149,438,555 (GRCm39) S34L unknown Het
Tspear T C 10: 77,665,463 (GRCm39) F83S probably benign Het
Ubr5 C A 15: 38,041,123 (GRCm39) A254S Het
Ubtfl1 A G 9: 18,321,459 (GRCm39) E329G probably benign Het
Vmn2r45 A G 7: 8,474,881 (GRCm39) W716R probably damaging Het
Vmn2r67 T C 7: 84,799,895 (GRCm39) M448V probably damaging Het
Wwc2 T G 8: 48,336,579 (GRCm39) I228L possibly damaging Het
Zbtb20 T C 16: 43,430,857 (GRCm39) V383A probably benign Het
Other mutations in Smoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Smoc2 APN 17 14,545,876 (GRCm39) missense probably damaging 1.00
IGL02085:Smoc2 APN 17 14,567,495 (GRCm39) missense possibly damaging 0.79
IGL02309:Smoc2 APN 17 14,595,789 (GRCm39) splice site probably benign
IGL02975:Smoc2 APN 17 14,556,872 (GRCm39) missense probably damaging 0.98
enamel UTSW 17 14,545,896 (GRCm39) missense probably damaging 1.00
FR4976:Smoc2 UTSW 17 14,621,824 (GRCm39) small deletion probably benign
R2291:Smoc2 UTSW 17 14,589,233 (GRCm39) missense possibly damaging 0.53
R2343:Smoc2 UTSW 17 14,564,604 (GRCm39) missense probably benign 0.22
R2888:Smoc2 UTSW 17 14,617,887 (GRCm39) critical splice donor site probably null
R3878:Smoc2 UTSW 17 14,545,879 (GRCm39) missense probably damaging 1.00
R4872:Smoc2 UTSW 17 14,589,295 (GRCm39) missense probably benign 0.12
R5153:Smoc2 UTSW 17 14,556,841 (GRCm39) missense probably damaging 1.00
R5175:Smoc2 UTSW 17 14,595,719 (GRCm39) missense possibly damaging 0.89
R5239:Smoc2 UTSW 17 14,589,227 (GRCm39) missense probably benign 0.19
R5292:Smoc2 UTSW 17 14,556,835 (GRCm39) missense probably damaging 0.98
R5794:Smoc2 UTSW 17 14,589,310 (GRCm39) missense possibly damaging 0.94
R7810:Smoc2 UTSW 17 14,545,884 (GRCm39) missense probably damaging 1.00
R7996:Smoc2 UTSW 17 14,595,730 (GRCm39) nonsense probably null
R9214:Smoc2 UTSW 17 14,556,839 (GRCm39) missense probably damaging 1.00
R9287:Smoc2 UTSW 17 14,619,686 (GRCm39) missense probably damaging 1.00
X0026:Smoc2 UTSW 17 14,556,895 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCAGAGCCTGTTCTCAGTCTG -3'
(R):5'- TTATGACAACATGAAACACTGAGGG -3'

Sequencing Primer
(F):5'- AGCCTGTTCTCAGTCTGCTTGG -3'
(R):5'- TGGTAGAGATCCTTGCCTAGCAC -3'
Posted On 2021-04-30