Incidental Mutation 'R8811:Abca17'
ID 672441
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A member 17
Synonyms
MMRRC Submission 068646-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8811 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 24483233-24570042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 24536212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 485 (K485T)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: K485T

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: K485T

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: K485T

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: K485T

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 87,280,023 (GRCm39) L337M probably damaging Het
Adcy4 T C 14: 56,010,221 (GRCm39) D687G probably benign Het
Aldoc T A 11: 78,215,610 (GRCm39) I98N probably damaging Het
Aoah T A 13: 21,184,121 (GRCm39) V395D probably damaging Het
Arap1 C T 7: 101,036,403 (GRCm39) R397W probably damaging Het
Arl16 A T 11: 120,357,526 (GRCm39) M63K probably damaging Het
Atf7 T C 15: 102,502,144 (GRCm39) D4G probably damaging Het
Atp6v0d2 A T 4: 19,922,397 (GRCm39) V34D probably benign Het
Calhm4 T A 10: 33,917,661 (GRCm39) K263N probably benign Het
Camk1g C G 1: 193,044,408 (GRCm39) G2A probably damaging Het
Cenpe A G 3: 134,929,001 (GRCm39) T302A probably damaging Het
Cps1 T C 1: 67,253,246 (GRCm39) V1246A probably benign Het
Csmd3 T C 15: 47,560,139 (GRCm39) D1397G Het
Ddx39b T A 17: 35,463,435 (GRCm39) S115T probably benign Het
Dnaja3 C A 16: 4,514,383 (GRCm39) T305K probably benign Het
Dusp7 C G 9: 106,248,241 (GRCm39) H290D probably benign Het
Emilin2 T A 17: 71,582,282 (GRCm39) D148V possibly damaging Het
Erbin C T 13: 104,022,824 (GRCm39) R5Q probably damaging Het
Fam3b T C 16: 97,313,715 (GRCm39) probably benign Het
Foxn3 T C 12: 99,162,951 (GRCm39) S317G probably benign Het
Gipc1 T A 8: 84,388,919 (GRCm39) M177K possibly damaging Het
Grpel2 A C 18: 61,851,823 (GRCm39) probably benign Het
Htr1a G C 13: 105,581,101 (GRCm39) A114P probably damaging Het
Iqch A T 9: 63,452,195 (GRCm39) M210K possibly damaging Het
Kdelr3 T C 15: 79,410,052 (GRCm39) I179T possibly damaging Het
Lat2 C T 5: 134,635,553 (GRCm39) probably benign Het
Mcrip1 A G 11: 120,435,605 (GRCm39) V10A probably damaging Het
Mib1 C T 18: 10,755,643 (GRCm39) L350F probably benign Het
Nhlrc2 T A 19: 56,583,344 (GRCm39) V605E probably benign Het
Nup133 AAGAGA AAGA 8: 124,638,627 (GRCm39) 900 probably null Het
Nutm2 A T 13: 50,623,989 (GRCm39) I229F probably benign Het
Or6f1 G A 7: 85,970,989 (GRCm39) T57M probably damaging Het
Phkb T C 8: 86,745,156 (GRCm39) V611A possibly damaging Het
Polg2 A T 11: 106,670,208 (GRCm39) Y21N probably benign Het
Prss28 T A 17: 25,528,627 (GRCm39) I23N probably benign Het
Ptprz1 G A 6: 23,030,661 (GRCm39) V1856I probably benign Het
Slc22a22 A T 15: 57,108,237 (GRCm39) I526N probably damaging Het
Slc24a4 T C 12: 102,180,133 (GRCm39) F68S probably damaging Het
Slc37a3 A G 6: 39,322,274 (GRCm39) S377P probably damaging Het
Smoc2 T C 17: 14,545,896 (GRCm39) S62P probably damaging Het
Sox4 A G 13: 29,136,911 (GRCm39) S32P probably damaging Het
Stxbp2 A T 8: 3,689,541 (GRCm39) Q426L Het
Synrg T G 11: 83,910,410 (GRCm39) S937A probably benign Het
Tbr1 C A 2: 61,642,196 (GRCm39) T487K possibly damaging Het
Tll2 T C 19: 41,195,012 (GRCm39) T25A probably benign Het
Trim31 T C 17: 37,210,875 (GRCm39) F169S probably benign Het
Tro G A X: 149,438,555 (GRCm39) S34L unknown Het
Tspear T C 10: 77,665,463 (GRCm39) F83S probably benign Het
Ubr5 C A 15: 38,041,123 (GRCm39) A254S Het
Ubtfl1 A G 9: 18,321,459 (GRCm39) E329G probably benign Het
Vmn2r45 A G 7: 8,474,881 (GRCm39) W716R probably damaging Het
Vmn2r67 T C 7: 84,799,895 (GRCm39) M448V probably damaging Het
Wwc2 T G 8: 48,336,579 (GRCm39) I228L possibly damaging Het
Zbtb20 T C 16: 43,430,857 (GRCm39) V383A probably benign Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24,514,165 (GRCm39) missense probably benign 0.14
IGL00585:Abca17 APN 17 24,519,294 (GRCm39) missense probably damaging 0.99
IGL00941:Abca17 APN 17 24,536,104 (GRCm39) missense probably damaging 1.00
IGL01987:Abca17 APN 17 24,565,202 (GRCm39) missense probably benign 0.00
IGL01988:Abca17 APN 17 24,553,229 (GRCm39) missense probably damaging 0.99
IGL02223:Abca17 APN 17 24,506,909 (GRCm39) nonsense probably null
IGL02368:Abca17 APN 17 24,506,767 (GRCm39) missense probably benign 0.01
IGL02405:Abca17 APN 17 24,498,036 (GRCm39) missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24,517,958 (GRCm39) missense probably benign 0.05
IGL02607:Abca17 APN 17 24,546,679 (GRCm39) nonsense probably null
IGL02706:Abca17 APN 17 24,517,966 (GRCm39) missense probably benign 0.00
IGL02729:Abca17 APN 17 24,499,455 (GRCm39) missense probably benign 0.06
IGL02818:Abca17 APN 17 24,519,326 (GRCm39) missense probably benign 0.02
IGL02891:Abca17 APN 17 24,500,340 (GRCm39) missense probably damaging 0.99
IGL03236:Abca17 APN 17 24,545,450 (GRCm39) splice site probably benign
IGL03299:Abca17 APN 17 24,484,565 (GRCm39) missense probably damaging 1.00
basin UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
Bowl UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R0018:Abca17 UTSW 17 24,532,162 (GRCm39) splice site probably null
R0467:Abca17 UTSW 17 24,532,151 (GRCm39) splice site probably benign
R0671:Abca17 UTSW 17 24,500,223 (GRCm39) missense probably benign 0.00
R1175:Abca17 UTSW 17 24,508,325 (GRCm39) missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24,504,733 (GRCm39) missense probably benign 0.18
R1398:Abca17 UTSW 17 24,547,511 (GRCm39) missense probably damaging 0.96
R1678:Abca17 UTSW 17 24,554,594 (GRCm39) missense probably benign 0.05
R1696:Abca17 UTSW 17 24,486,632 (GRCm39) missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24,486,531 (GRCm39) missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24,486,690 (GRCm39) missense probably damaging 1.00
R1970:Abca17 UTSW 17 24,526,549 (GRCm39) missense probably benign 0.00
R1997:Abca17 UTSW 17 24,504,700 (GRCm39) missense probably benign 0.02
R2141:Abca17 UTSW 17 24,553,240 (GRCm39) missense probably benign 0.00
R2199:Abca17 UTSW 17 24,554,598 (GRCm39) missense probably benign 0.19
R2394:Abca17 UTSW 17 24,500,190 (GRCm39) splice site probably null
R2442:Abca17 UTSW 17 24,547,606 (GRCm39) missense probably benign 0.02
R2509:Abca17 UTSW 17 24,508,587 (GRCm39) splice site probably benign
R2848:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2849:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2859:Abca17 UTSW 17 24,500,288 (GRCm39) missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2935:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3153:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3154:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3434:Abca17 UTSW 17 24,508,511 (GRCm39) missense probably damaging 1.00
R3695:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3905:Abca17 UTSW 17 24,515,257 (GRCm39) missense probably benign 0.13
R4282:Abca17 UTSW 17 24,518,034 (GRCm39) missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24,537,242 (GRCm39) missense probably damaging 1.00
R4350:Abca17 UTSW 17 24,498,020 (GRCm39) critical splice donor site probably null
R4548:Abca17 UTSW 17 24,553,245 (GRCm39) missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24,540,058 (GRCm39) missense probably damaging 1.00
R4722:Abca17 UTSW 17 24,484,403 (GRCm39) missense probably damaging 1.00
R4745:Abca17 UTSW 17 24,526,427 (GRCm39) missense probably damaging 1.00
R4818:Abca17 UTSW 17 24,536,135 (GRCm39) missense probably damaging 0.98
R5279:Abca17 UTSW 17 24,508,388 (GRCm39) missense probably damaging 1.00
R5310:Abca17 UTSW 17 24,500,204 (GRCm39) missense probably benign 0.00
R5320:Abca17 UTSW 17 24,526,541 (GRCm39) missense probably damaging 1.00
R5435:Abca17 UTSW 17 24,486,588 (GRCm39) missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24,546,642 (GRCm39) missense probably benign 0.14
R5776:Abca17 UTSW 17 24,514,132 (GRCm39) missense probably benign 0.09
R5928:Abca17 UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
R6013:Abca17 UTSW 17 24,506,820 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24,537,165 (GRCm39) missense probably benign 0.00
R6063:Abca17 UTSW 17 24,483,318 (GRCm39) missense unknown
R6404:Abca17 UTSW 17 24,484,892 (GRCm39) missense probably benign 0.13
R6746:Abca17 UTSW 17 24,565,195 (GRCm39) nonsense probably null
R6819:Abca17 UTSW 17 24,506,767 (GRCm39) missense probably benign 0.01
R6828:Abca17 UTSW 17 24,545,389 (GRCm39) missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24,484,474 (GRCm39) missense probably damaging 1.00
R7065:Abca17 UTSW 17 24,546,725 (GRCm39) missense probably damaging 1.00
R7123:Abca17 UTSW 17 24,484,949 (GRCm39) missense probably damaging 1.00
R7157:Abca17 UTSW 17 24,554,564 (GRCm39) missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24,554,600 (GRCm39) missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24,539,983 (GRCm39) missense not run
R7352:Abca17 UTSW 17 24,508,028 (GRCm39) nonsense probably null
R7355:Abca17 UTSW 17 24,486,621 (GRCm39) missense probably benign 0.00
R7358:Abca17 UTSW 17 24,510,529 (GRCm39) missense probably benign 0.00
R7411:Abca17 UTSW 17 24,547,543 (GRCm39) missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24,484,507 (GRCm39) missense probably damaging 1.00
R8039:Abca17 UTSW 17 24,547,699 (GRCm39) missense probably damaging 1.00
R8095:Abca17 UTSW 17 24,536,196 (GRCm39) missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24,486,657 (GRCm39) missense probably damaging 1.00
R8517:Abca17 UTSW 17 24,536,207 (GRCm39) missense probably benign 0.00
R8819:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8820:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8953:Abca17 UTSW 17 24,518,015 (GRCm39) missense probably benign
R9095:Abca17 UTSW 17 24,500,370 (GRCm39) missense probably damaging 0.97
R9313:Abca17 UTSW 17 24,565,207 (GRCm39) missense probably benign 0.00
R9314:Abca17 UTSW 17 24,547,593 (GRCm39) missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24,483,479 (GRCm39) missense probably benign
R9351:Abca17 UTSW 17 24,510,751 (GRCm39) missense probably benign 0.00
R9387:Abca17 UTSW 17 24,553,255 (GRCm39) missense probably benign 0.02
R9388:Abca17 UTSW 17 24,483,273 (GRCm39) missense unknown
R9440:Abca17 UTSW 17 24,499,452 (GRCm39) missense probably benign 0.02
R9498:Abca17 UTSW 17 24,484,480 (GRCm39) missense probably damaging 1.00
R9654:Abca17 UTSW 17 24,536,099 (GRCm39) missense probably benign 0.09
R9709:Abca17 UTSW 17 24,517,934 (GRCm39) missense probably benign
R9770:Abca17 UTSW 17 24,514,121 (GRCm39) missense probably benign 0.00
R9773:Abca17 UTSW 17 24,508,565 (GRCm39) missense probably damaging 1.00
RF024:Abca17 UTSW 17 24,506,706 (GRCm39) frame shift probably null
RF029:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
RF032:Abca17 UTSW 17 24,506,701 (GRCm39) frame shift probably null
RF036:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
X0017:Abca17 UTSW 17 24,536,137 (GRCm39) missense probably benign 0.26
X0065:Abca17 UTSW 17 24,553,258 (GRCm39) missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24,498,081 (GRCm39) missense probably benign 0.03
Z1088:Abca17 UTSW 17 24,498,053 (GRCm39) missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24,565,193 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCTTAGAGGGTTGTTTCTCAAGTC -3'
(R):5'- GGCCTGCCAGGGATTATAGATG -3'

Sequencing Primer
(F):5'- TCCTGTAGAGGAAATTAGAAAGCC -3'
(R):5'- CCTGCCAGGGATTATAGATGATCTAG -3'
Posted On 2021-04-30