Incidental Mutation 'R8811:Nhlrc2'
ID672449
Institutional Source Beutler Lab
Gene Symbol Nhlrc2
Ensembl Gene ENSMUSG00000025078
Gene NameNHL repeat containing 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8811 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location56548261-56598846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56594912 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 605 (V605E)
Ref Sequence ENSEMBL: ENSMUSP00000071370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423]
Predicted Effect probably benign
Transcript: ENSMUST00000071423
AA Change: V605E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078
AA Change: V605E

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T G 17: 24,317,238 K485T probably benign Het
Abcc12 G T 8: 86,553,394 L337M probably damaging Het
Adcy4 T C 14: 55,772,764 D687G probably benign Het
Aldoc T A 11: 78,324,784 I98N probably damaging Het
Aoah T A 13: 20,999,951 V395D probably damaging Het
Arap1 C T 7: 101,387,196 R397W probably damaging Het
Arl16 A T 11: 120,466,700 M63K probably damaging Het
Atf7 T C 15: 102,593,709 D4G probably damaging Het
Atp6v0d2 A T 4: 19,922,397 V34D probably benign Het
Camk1g C G 1: 193,362,100 G2A probably damaging Het
Cenpe A G 3: 135,223,240 T302A probably damaging Het
Cps1 T C 1: 67,214,087 V1246A probably benign Het
Csmd3 T C 15: 47,696,743 D1397G Het
Ddx39b T A 17: 35,244,459 S115T probably benign Het
Dnaja3 C A 16: 4,696,519 T305K probably benign Het
Dusp7 C G 9: 106,371,042 H290D probably benign Het
Emilin2 T A 17: 71,275,287 D148V possibly damaging Het
Erbin C T 13: 103,886,316 R5Q probably damaging Het
Fam26d T A 10: 34,041,665 K263N probably benign Het
Fam3b T C 16: 97,512,515 probably benign Het
Foxn3 T C 12: 99,196,692 S317G probably benign Het
Gipc1 T A 8: 83,662,290 M177K possibly damaging Het
Grpel2 A C 18: 61,718,752 probably benign Het
Htr1a G C 13: 105,444,593 A114P probably damaging Het
Iqch A T 9: 63,544,913 M210K possibly damaging Het
Kdelr3 T C 15: 79,525,851 I179T possibly damaging Het
Mcrip1 A G 11: 120,544,779 V10A probably damaging Het
Mib1 C T 18: 10,755,643 L350F probably benign Het
Nup133 AAGAGA AAGA 8: 123,911,888 probably null Het
Nutm2 A T 13: 50,469,953 I229F probably benign Het
Olfr308 G A 7: 86,321,781 T57M probably damaging Het
Phkb T C 8: 86,018,527 V611A possibly damaging Het
Polg2 A T 11: 106,779,382 Y21N probably benign Het
Prss28 T A 17: 25,309,653 I23N probably benign Het
Ptprz1 G A 6: 23,030,662 V1856I probably benign Het
Slc22a22 A T 15: 57,244,841 I526N probably damaging Het
Slc24a4 T C 12: 102,213,874 F68S probably damaging Het
Slc37a3 A G 6: 39,345,340 S377P probably damaging Het
Smoc2 T C 17: 14,325,634 S62P probably damaging Het
Sox4 A G 13: 28,952,928 S32P probably damaging Het
Stxbp2 A T 8: 3,639,541 Q426L Het
Synrg T G 11: 84,019,584 S937A probably benign Het
Tbr1 C A 2: 61,811,852 T487K possibly damaging Het
Tll2 T C 19: 41,206,573 T25A probably benign Het
Trim31 T C 17: 36,899,983 F169S probably benign Het
Tro G A X: 150,655,559 S34L unknown Het
Tspear T C 10: 77,829,629 F83S probably benign Het
Ubr5 C A 15: 38,040,879 A254S Het
Ubtfl1 A G 9: 18,410,163 E329G probably benign Het
Vmn2r45 A G 7: 8,471,882 W716R probably damaging Het
Vmn2r67 T C 7: 85,150,687 M448V probably damaging Het
Wwc2 T G 8: 47,883,544 I228L possibly damaging Het
Zbtb20 T C 16: 43,610,494 V383A probably benign Het
Other mutations in Nhlrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Nhlrc2 APN 19 56551799 nonsense probably null
IGL01524:Nhlrc2 APN 19 56576155 missense probably benign 0.39
IGL01570:Nhlrc2 APN 19 56574787 missense possibly damaging 0.87
IGL01653:Nhlrc2 APN 19 56570850 missense probably benign 0.25
IGL02256:Nhlrc2 APN 19 56597361 missense probably benign 0.10
IGL02303:Nhlrc2 APN 19 56574848 missense probably damaging 1.00
IGL02349:Nhlrc2 APN 19 56591719 missense possibly damaging 0.94
IGL02501:Nhlrc2 APN 19 56570654 nonsense probably null
R0270:Nhlrc2 UTSW 19 56551870 missense probably damaging 1.00
R0454:Nhlrc2 UTSW 19 56570527 missense probably damaging 1.00
R2022:Nhlrc2 UTSW 19 56597278 missense probably benign 0.06
R3854:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3855:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3856:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R4659:Nhlrc2 UTSW 19 56576267 missense possibly damaging 0.86
R4767:Nhlrc2 UTSW 19 56570466 missense probably benign 0.03
R4992:Nhlrc2 UTSW 19 56570534 missense probably benign 0.00
R5877:Nhlrc2 UTSW 19 56570584 missense probably damaging 1.00
R6191:Nhlrc2 UTSW 19 56570859 missense probably benign 0.00
R6755:Nhlrc2 UTSW 19 56591784 missense probably benign 0.12
R7164:Nhlrc2 UTSW 19 56592499 missense probably damaging 1.00
R7507:Nhlrc2 UTSW 19 56597378 missense not run
R7609:Nhlrc2 UTSW 19 56594896 missense probably benign
R8849:Nhlrc2 UTSW 19 56591752 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCTCGCTTTGGTCCTGAAAGTG -3'
(R):5'- AGAGTCACGCTTCACACCAG -3'

Sequencing Primer
(F):5'- CCTGAAAGTGCTCTGCTTTAACAAC -3'
(R):5'- GCTTCACACCAGGTCCC -3'
Posted On2021-04-30