Incidental Mutation 'R8812:Adcy10'
ID 672454
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 068647-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R8812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 165378867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 885 (Q885H)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: Q885H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: Q885H

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: Q885H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: Q885H

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: Q885H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: Q885H

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,480,471 (GRCm39) P1167Q probably damaging Het
Abtb3 A G 10: 85,463,113 (GRCm39) Q626R probably damaging Het
Alkal2 C T 12: 30,940,055 (GRCm39) L139F probably damaging Het
Ankrd17 A T 5: 90,441,062 (GRCm39) M439K probably benign Het
Arl11 C A 14: 61,548,422 (GRCm39) Y77* probably null Het
Bcas3 T C 11: 85,449,973 (GRCm39) Y669H probably benign Het
Bpifb3 C T 2: 153,764,516 (GRCm39) A136V probably benign Het
Ccne2 A G 4: 11,202,279 (GRCm39) T345A probably benign Het
Ciz1 T C 2: 32,254,286 (GRCm39) S76P probably benign Het
Clip4 A T 17: 72,107,800 (GRCm39) K94* probably null Het
Cthrc1 G A 15: 38,947,866 (GRCm39) R195H probably damaging Het
Ddx31 T C 2: 28,730,816 (GRCm39) probably benign Het
Elf2 T A 3: 51,174,188 (GRCm39) D113V possibly damaging Het
Esrrb A G 12: 86,535,324 (GRCm39) N155S probably benign Het
Flnb A G 14: 7,887,624 (GRCm38) D478G probably benign Het
Galm T A 17: 80,435,215 (GRCm39) L24H probably damaging Het
Gask1b T C 3: 79,816,078 (GRCm39) S363P possibly damaging Het
Gon4l G A 3: 88,802,314 (GRCm39) G975D possibly damaging Het
Hspbp1 T G 7: 4,667,783 (GRCm39) M237L probably benign Het
Ighv1-62-1 A T 12: 115,350,367 (GRCm39) M100K probably damaging Het
Ipo8 A T 6: 148,676,575 (GRCm39) D971E possibly damaging Het
Itgax C T 7: 127,732,979 (GRCm39) A286V probably damaging Het
Jpt2 T C 17: 25,179,578 (GRCm39) Q3R probably benign Het
Katnip A C 7: 125,396,867 (GRCm39) R309S probably benign Het
Klrg2 A C 6: 38,613,838 (GRCm39) L55R probably damaging Het
Lrp6 T A 6: 134,433,141 (GRCm39) M1397L probably benign Het
Lrrc31 T A 3: 30,733,328 (GRCm39) Q462L probably benign Het
Lyg2 T A 1: 37,949,054 (GRCm39) I103F probably damaging Het
Map10 T C 8: 126,396,664 (GRCm39) V19A probably damaging Het
Map1b T A 13: 99,569,323 (GRCm39) M1133L unknown Het
Mrgpra4 A G 7: 47,631,481 (GRCm39) V40A probably benign Het
Myh1 G A 11: 67,099,967 (GRCm39) G626R probably benign Het
Myo9a T C 9: 59,687,030 (GRCm39) V45A probably benign Het
Ncdn A G 4: 126,638,905 (GRCm39) F638S possibly damaging Het
Ncs1 T A 2: 31,174,213 (GRCm39) M121K probably damaging Het
Nf1 T C 11: 79,437,180 (GRCm39) V16A probably damaging Het
Nktr T A 9: 121,579,317 (GRCm39) D1128E unknown Het
Nup205 T G 6: 35,191,269 (GRCm39) L1000R probably damaging Het
Obscn T C 11: 58,925,921 (GRCm39) E5604G probably damaging Het
Or1p4-ps1 T A 11: 74,208,534 (GRCm39) S228T unknown Het
Or2p2 T C 13: 21,257,220 (GRCm39) N84D probably damaging Het
Or4a68 A G 2: 89,270,209 (GRCm39) V138A probably benign Het
Or4c35 G T 2: 89,808,715 (GRCm39) A198S possibly damaging Het
Or51ah3 G T 7: 103,209,816 (GRCm39) C44F probably benign Het
Or5b96 A T 19: 12,867,560 (GRCm39) V127E probably damaging Het
Or7g12 A G 9: 18,899,812 (GRCm39) H176R possibly damaging Het
Ovch2 T A 7: 107,392,462 (GRCm39) I294F probably damaging Het
Ovch2 A T 7: 107,393,251 (GRCm39) C207* probably null Het
P3h2 T A 16: 25,801,467 (GRCm39) Y397F possibly damaging Het
Pappa A T 4: 65,123,166 (GRCm39) I834F possibly damaging Het
Pcdha11 T C 18: 37,140,716 (GRCm39) S782P probably benign Het
Pex1 T C 5: 3,681,614 (GRCm39) V980A probably benign Het
Pik3c2a G T 7: 115,951,112 (GRCm39) L1258I probably damaging Het
Pmp22 T A 11: 63,049,239 (GRCm39) *161R probably null Het
Ppp1r26 T A 2: 28,341,192 (GRCm39) M274K probably benign Het
Ppp6r2 T C 15: 89,167,275 (GRCm39) V830A probably benign Het
Pramel34 T C 5: 93,785,660 (GRCm39) T207A possibly damaging Het
Prss1 T A 6: 41,439,520 (GRCm39) N84K probably benign Het
Rab3il1 G A 19: 10,004,141 (GRCm39) A18T probably damaging Het
Sbf2 A T 7: 109,929,069 (GRCm39) S1471T probably damaging Het
Setdb1 T A 3: 95,263,371 (GRCm39) D45V probably damaging Het
Sik3 G T 9: 46,089,811 (GRCm39) V275L probably benign Het
Skint6 C A 4: 112,846,149 (GRCm39) M659I probably benign Het
Slc24a1 T A 9: 64,835,985 (GRCm39) D714V unknown Het
Slc26a5 T A 5: 22,018,880 (GRCm39) D653V probably damaging Het
Snrnp27 A T 6: 86,653,196 (GRCm39) C141S probably benign Het
Stradb A G 1: 59,033,478 (GRCm39) I380M probably benign Het
Sult1e1 T C 5: 87,735,501 (GRCm39) Y59C probably benign Het
Tas2r122 C T 6: 132,688,702 (GRCm39) A64T probably benign Het
Tep1 C T 14: 51,074,589 (GRCm39) C1812Y probably damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trio A T 15: 27,905,311 (GRCm39) C152S unknown Het
Tro G A X: 149,438,555 (GRCm39) S34L unknown Het
Vmn1r15 A G 6: 57,235,123 (GRCm39) probably benign Het
Vmn1r19 A G 6: 57,381,436 (GRCm39) probably benign Het
Vmn1r75 A G 7: 11,614,630 (GRCm39) T121A possibly damaging Het
Vmn2r32 A G 7: 7,477,669 (GRCm39) F241L probably damaging Het
Vmn2r66 A G 7: 84,654,893 (GRCm39) L472P probably damaging Het
Ylpm1 G T 12: 85,043,566 (GRCm39) W101C unknown Het
Zdbf2 C A 1: 63,347,272 (GRCm39) H1884N probably benign Het
Zfp1005 T A 2: 150,109,624 (GRCm39) C105S possibly damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCAGATGCTGGTGAGATGCG -3'
(R):5'- ACAAACCAGCTGCTCCTTTC -3'

Sequencing Primer
(F):5'- AGATGCGCTGCCATCATTG -3'
(R):5'- GGCATCGGATTCCCATTACAGATG -3'
Posted On 2021-04-30