Incidental Mutation 'R8812:Gask1b'
ID 672465
Institutional Source Beutler Lab
Gene Symbol Gask1b
Ensembl Gene ENSMUSG00000027955
Gene Name golgi associated kinase 1B
Synonyms Ened, 2210419I08Rik, Fam198b, 1110032E23Rik
MMRRC Submission 068647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 79791840-79853587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79816078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 363 (S363P)
Ref Sequence ENSEMBL: ENSMUSP00000029567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029567] [ENSMUST00000118853] [ENSMUST00000145992]
AlphaFold Q3UPI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000029567
AA Change: S363P

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029567
Gene: ENSMUSG00000027955
AA Change: S363P

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:FAM198 202 516 9.1e-156 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118853
AA Change: S363P

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114093
Gene: ENSMUSG00000027955
AA Change: S363P

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:FAM198 202 516 1.1e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145992
SMART Domains Protein: ENSMUSP00000120603
Gene: ENSMUSG00000027955

DomainStartEndE-ValueType
Pfam:FAM198 1 51 5.4e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,480,471 (GRCm39) P1167Q probably damaging Het
Abtb3 A G 10: 85,463,113 (GRCm39) Q626R probably damaging Het
Adcy10 A T 1: 165,378,867 (GRCm39) Q885H probably damaging Het
Alkal2 C T 12: 30,940,055 (GRCm39) L139F probably damaging Het
Ankrd17 A T 5: 90,441,062 (GRCm39) M439K probably benign Het
Arl11 C A 14: 61,548,422 (GRCm39) Y77* probably null Het
Bcas3 T C 11: 85,449,973 (GRCm39) Y669H probably benign Het
Bpifb3 C T 2: 153,764,516 (GRCm39) A136V probably benign Het
Ccne2 A G 4: 11,202,279 (GRCm39) T345A probably benign Het
Ciz1 T C 2: 32,254,286 (GRCm39) S76P probably benign Het
Clip4 A T 17: 72,107,800 (GRCm39) K94* probably null Het
Cthrc1 G A 15: 38,947,866 (GRCm39) R195H probably damaging Het
Ddx31 T C 2: 28,730,816 (GRCm39) probably benign Het
Elf2 T A 3: 51,174,188 (GRCm39) D113V possibly damaging Het
Esrrb A G 12: 86,535,324 (GRCm39) N155S probably benign Het
Flnb A G 14: 7,887,624 (GRCm38) D478G probably benign Het
Galm T A 17: 80,435,215 (GRCm39) L24H probably damaging Het
Gon4l G A 3: 88,802,314 (GRCm39) G975D possibly damaging Het
Hspbp1 T G 7: 4,667,783 (GRCm39) M237L probably benign Het
Ighv1-62-1 A T 12: 115,350,367 (GRCm39) M100K probably damaging Het
Ipo8 A T 6: 148,676,575 (GRCm39) D971E possibly damaging Het
Itgax C T 7: 127,732,979 (GRCm39) A286V probably damaging Het
Jpt2 T C 17: 25,179,578 (GRCm39) Q3R probably benign Het
Katnip A C 7: 125,396,867 (GRCm39) R309S probably benign Het
Klrg2 A C 6: 38,613,838 (GRCm39) L55R probably damaging Het
Lrp6 T A 6: 134,433,141 (GRCm39) M1397L probably benign Het
Lrrc31 T A 3: 30,733,328 (GRCm39) Q462L probably benign Het
Lyg2 T A 1: 37,949,054 (GRCm39) I103F probably damaging Het
Map10 T C 8: 126,396,664 (GRCm39) V19A probably damaging Het
Map1b T A 13: 99,569,323 (GRCm39) M1133L unknown Het
Mrgpra4 A G 7: 47,631,481 (GRCm39) V40A probably benign Het
Myh1 G A 11: 67,099,967 (GRCm39) G626R probably benign Het
Myo9a T C 9: 59,687,030 (GRCm39) V45A probably benign Het
Ncdn A G 4: 126,638,905 (GRCm39) F638S possibly damaging Het
Ncs1 T A 2: 31,174,213 (GRCm39) M121K probably damaging Het
Nf1 T C 11: 79,437,180 (GRCm39) V16A probably damaging Het
Nktr T A 9: 121,579,317 (GRCm39) D1128E unknown Het
Nup205 T G 6: 35,191,269 (GRCm39) L1000R probably damaging Het
Obscn T C 11: 58,925,921 (GRCm39) E5604G probably damaging Het
Or1p4-ps1 T A 11: 74,208,534 (GRCm39) S228T unknown Het
Or2p2 T C 13: 21,257,220 (GRCm39) N84D probably damaging Het
Or4a68 A G 2: 89,270,209 (GRCm39) V138A probably benign Het
Or4c35 G T 2: 89,808,715 (GRCm39) A198S possibly damaging Het
Or51ah3 G T 7: 103,209,816 (GRCm39) C44F probably benign Het
Or5b96 A T 19: 12,867,560 (GRCm39) V127E probably damaging Het
Or7g12 A G 9: 18,899,812 (GRCm39) H176R possibly damaging Het
Ovch2 T A 7: 107,392,462 (GRCm39) I294F probably damaging Het
Ovch2 A T 7: 107,393,251 (GRCm39) C207* probably null Het
P3h2 T A 16: 25,801,467 (GRCm39) Y397F possibly damaging Het
Pappa A T 4: 65,123,166 (GRCm39) I834F possibly damaging Het
Pcdha11 T C 18: 37,140,716 (GRCm39) S782P probably benign Het
Pex1 T C 5: 3,681,614 (GRCm39) V980A probably benign Het
Pik3c2a G T 7: 115,951,112 (GRCm39) L1258I probably damaging Het
Pmp22 T A 11: 63,049,239 (GRCm39) *161R probably null Het
Ppp1r26 T A 2: 28,341,192 (GRCm39) M274K probably benign Het
Ppp6r2 T C 15: 89,167,275 (GRCm39) V830A probably benign Het
Pramel34 T C 5: 93,785,660 (GRCm39) T207A possibly damaging Het
Prss1 T A 6: 41,439,520 (GRCm39) N84K probably benign Het
Rab3il1 G A 19: 10,004,141 (GRCm39) A18T probably damaging Het
Sbf2 A T 7: 109,929,069 (GRCm39) S1471T probably damaging Het
Setdb1 T A 3: 95,263,371 (GRCm39) D45V probably damaging Het
Sik3 G T 9: 46,089,811 (GRCm39) V275L probably benign Het
Skint6 C A 4: 112,846,149 (GRCm39) M659I probably benign Het
Slc24a1 T A 9: 64,835,985 (GRCm39) D714V unknown Het
Slc26a5 T A 5: 22,018,880 (GRCm39) D653V probably damaging Het
Snrnp27 A T 6: 86,653,196 (GRCm39) C141S probably benign Het
Stradb A G 1: 59,033,478 (GRCm39) I380M probably benign Het
Sult1e1 T C 5: 87,735,501 (GRCm39) Y59C probably benign Het
Tas2r122 C T 6: 132,688,702 (GRCm39) A64T probably benign Het
Tep1 C T 14: 51,074,589 (GRCm39) C1812Y probably damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trio A T 15: 27,905,311 (GRCm39) C152S unknown Het
Tro G A X: 149,438,555 (GRCm39) S34L unknown Het
Vmn1r15 A G 6: 57,235,123 (GRCm39) probably benign Het
Vmn1r19 A G 6: 57,381,436 (GRCm39) probably benign Het
Vmn1r75 A G 7: 11,614,630 (GRCm39) T121A possibly damaging Het
Vmn2r32 A G 7: 7,477,669 (GRCm39) F241L probably damaging Het
Vmn2r66 A G 7: 84,654,893 (GRCm39) L472P probably damaging Het
Ylpm1 G T 12: 85,043,566 (GRCm39) W101C unknown Het
Zdbf2 C A 1: 63,347,272 (GRCm39) H1884N probably benign Het
Zfp1005 T A 2: 150,109,624 (GRCm39) C105S possibly damaging Het
Other mutations in Gask1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02952:Gask1b APN 3 79,793,646 (GRCm39) missense probably damaging 1.00
P0015:Gask1b UTSW 3 79,843,915 (GRCm39) missense probably damaging 1.00
PIT4362001:Gask1b UTSW 3 79,794,246 (GRCm39) missense possibly damaging 0.78
R1519:Gask1b UTSW 3 79,848,771 (GRCm39) missense possibly damaging 0.88
R1723:Gask1b UTSW 3 79,843,970 (GRCm39) missense probably benign
R1782:Gask1b UTSW 3 79,793,838 (GRCm39) missense possibly damaging 0.85
R3040:Gask1b UTSW 3 79,794,432 (GRCm39) missense possibly damaging 0.95
R3840:Gask1b UTSW 3 79,815,897 (GRCm39) missense probably benign 0.32
R4841:Gask1b UTSW 3 79,843,912 (GRCm39) missense probably damaging 1.00
R4842:Gask1b UTSW 3 79,843,912 (GRCm39) missense probably damaging 1.00
R4860:Gask1b UTSW 3 79,843,981 (GRCm39) nonsense probably null
R4860:Gask1b UTSW 3 79,843,981 (GRCm39) nonsense probably null
R5181:Gask1b UTSW 3 79,793,618 (GRCm39) missense probably benign 0.08
R5266:Gask1b UTSW 3 79,843,910 (GRCm39) missense probably damaging 0.96
R6353:Gask1b UTSW 3 79,848,647 (GRCm39) missense probably damaging 1.00
R6698:Gask1b UTSW 3 79,843,902 (GRCm39) missense probably damaging 0.97
R6856:Gask1b UTSW 3 79,793,448 (GRCm39) intron probably benign
R6927:Gask1b UTSW 3 79,848,769 (GRCm39) missense probably damaging 1.00
R7025:Gask1b UTSW 3 79,793,855 (GRCm39) missense probably damaging 1.00
R7189:Gask1b UTSW 3 79,794,114 (GRCm39) nonsense probably null
R7434:Gask1b UTSW 3 79,848,669 (GRCm39) missense probably damaging 1.00
R7557:Gask1b UTSW 3 79,793,915 (GRCm39) nonsense probably null
R7780:Gask1b UTSW 3 79,848,711 (GRCm39) missense probably damaging 1.00
R7891:Gask1b UTSW 3 79,793,591 (GRCm39) missense probably benign 0.00
R8841:Gask1b UTSW 3 79,794,426 (GRCm39) missense probably benign 0.08
R8960:Gask1b UTSW 3 79,794,293 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCCTATCATTCTCTGGGAC -3'
(R):5'- ACCTCGGAGGATTCTGTTTCC -3'

Sequencing Primer
(F):5'- GGGACTCATCTCTAGCATCTGCAAG -3'
(R):5'- GGAGGATTCTGTTTCCACTCCTG -3'
Posted On 2021-04-30