Mutagenetix > Incidental Mutation

Incidental Mutation 'R8812:Gon4l'

672466

Institutional Source

Beutler Lab

Gene Symbol

Gon4l

Ensembl Gene

ENSMUSG00000054199

Gene Name

gon-4-like (C.elegans)

Synonyms

2610100B20Rik, 1500041I23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.844) question?

Stock #

R8812 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88835231-88910103 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88895007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 975 (G975D)

Ref Sequence

ENSEMBL: ENSMUSP00000103122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081695
AA Change: G975D

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: G975D

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090942
AA Change: G976D

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: G976D

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	241	257	N/A	INTRINSIC
low complexity region	349	378	N/A	INTRINSIC
low complexity region	433	440	N/A	INTRINSIC
low complexity region	528	543	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
Blast:SANT	814	866	2e-23	BLAST
low complexity region	962	976	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1419	1435	N/A	INTRINSIC
low complexity region	1453	1498	N/A	INTRINSIC
low complexity region	1508	1542	N/A	INTRINSIC
Pfam:PAH	1654	1700	2.1e-8	PFAM
low complexity region	1801	1812	N/A	INTRINSIC
coiled coil region	1920	1944	N/A	INTRINSIC
low complexity region	2086	2095	N/A	INTRINSIC
SANT	2154	2205	2.2e-1	SMART
low complexity region	2208	2223	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107498
AA Change: G975D

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: G975D

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	150	163	N/A	INTRINSIC
low complexity region	240	256	N/A	INTRINSIC
low complexity region	348	377	N/A	INTRINSIC
low complexity region	432	439	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	683	696	N/A	INTRINSIC
Blast:SANT	813	865	1e-23	BLAST
low complexity region	961	975	N/A	INTRINSIC
low complexity region	1311	1329	N/A	INTRINSIC
low complexity region	1418	1434	N/A	INTRINSIC
low complexity region	1452	1497	N/A	INTRINSIC
low complexity region	1507	1541	N/A	INTRINSIC
Pfam:PAH	1652	1700	8.8e-9	PFAM
low complexity region	1800	1811	N/A	INTRINSIC
coiled coil region	1919	1943	N/A	INTRINSIC
low complexity region	2085	2094	N/A	INTRINSIC
SANT	2153	2204	2.2e-1	SMART
low complexity region	2207	2222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212694

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	A	13: 77,332,352	P1167Q	probably damaging	Het
Adcy10	A	T	1: 165,551,298	Q885H	probably damaging	Het
Alkal2	C	T	12: 30,890,056	L139F	probably damaging	Het
Ankrd17	A	T	5: 90,293,203	M439K	probably benign	Het
Arl11	C	A	14: 61,310,973	Y77*	probably null	Het
Bcas3	T	C	11: 85,559,147	Y669H	probably benign	Het
Bpifb3	C	T	2: 153,922,596	A136V	probably benign	Het
Btbd11	A	G	10: 85,627,249	Q626R	probably damaging	Het
C87414	T	C	5: 93,637,801	T207A	possibly damaging	Het
Ccne2	A	G	4: 11,202,279	T345A	probably benign	Het
Ciz1	T	C	2: 32,364,274	S76P	probably benign	Het
Clip4	A	T	17: 71,800,805	K94*	probably null	Het
Cthrc1	G	A	15: 39,084,471	R195H	probably damaging	Het
D430042O09Rik	A	C	7: 125,797,695	R309S	probably benign	Het
Ddx31	T	C	2: 28,840,804		probably benign	Het
Elf2	T	A	3: 51,266,767	D113V	possibly damaging	Het
Esrrb	A	G	12: 86,488,550	N155S	probably benign	Het
Fam198b	T	C	3: 79,908,771	S363P	possibly damaging	Het
Flnb	A	G	14: 7,887,624	D478G	probably benign	Het
Galm	T	A	17: 80,127,786	L24H	probably damaging	Het
Gm14124	T	A	2: 150,267,704	C105S	possibly damaging	Het
Hspbp1	T	G	7: 4,664,784	M237L	probably benign	Het
Ighv1-62-1	A	T	12: 115,386,747	M100K	probably damaging	Het
Ipo8	A	T	6: 148,775,077	D971E	possibly damaging	Het
Itgax	C	T	7: 128,133,807	A286V	probably damaging	Het
Jpt2	T	C	17: 24,960,604	Q3R	probably benign	Het
Klrg2	A	C	6: 38,636,903	L55R	probably damaging	Het
Lrp6	T	A	6: 134,456,178	M1397L	probably benign	Het
Lrrc31	T	A	3: 30,679,179	Q462L	probably benign	Het
Lyg2	T	A	1: 37,909,973	I103F	probably damaging	Het
Map10	T	C	8: 125,669,925	V19A	probably damaging	Het
Map1b	T	A	13: 99,432,815	M1133L	unknown	Het
Mrgpra4	A	G	7: 47,981,733	V40A	probably benign	Het
Myh1	G	A	11: 67,209,141	G626R	probably benign	Het
Myo9a	T	C	9: 59,779,747	V45A	probably benign	Het
Ncdn	A	G	4: 126,745,112	F638S	possibly damaging	Het
Ncs1	T	A	2: 31,284,201	M121K	probably damaging	Het
Nf1	T	C	11: 79,546,354	V16A	probably damaging	Het
Nktr	T	A	9: 121,750,251	D1128E	unknown	Het
Nup205	T	G	6: 35,214,334	L1000R	probably damaging	Het
Obscn	T	C	11: 59,035,095	E5604G	probably damaging	Het
Olfr1240	A	G	2: 89,439,865	V138A	probably benign	Het
Olfr1260	G	T	2: 89,978,371	A198S	possibly damaging	Het
Olfr1370	T	C	13: 21,073,050	N84D	probably damaging	Het
Olfr1446	A	T	19: 12,890,196	V127E	probably damaging	Het
Olfr409-ps1	T	A	11: 74,317,708	S228T	unknown	Het
Olfr615	G	T	7: 103,560,609	C44F	probably benign	Het
Olfr834	A	G	9: 18,988,516	H176R	possibly damaging	Het
Ovch2	T	A	7: 107,793,255	I294F	probably damaging	Het
Ovch2	A	T	7: 107,794,044	C207*	probably null	Het
P3h2	T	A	16: 25,982,717	Y397F	possibly damaging	Het
Pappa	A	T	4: 65,204,929	I834F	possibly damaging	Het
Pcdha11	T	C	18: 37,007,663	S782P	probably benign	Het
Pex1	T	C	5: 3,631,614	V980A	probably benign	Het
Pik3c2a	G	T	7: 116,351,877	L1258I	probably damaging	Het
Pmp22	T	A	11: 63,158,413	*161R	probably null	Het
Ppp1r26	T	A	2: 28,451,180	M274K	probably benign	Het
Ppp6r2	T	C	15: 89,283,072	V830A	probably benign	Het
Prss1	T	A	6: 41,462,586	N84K	probably benign	Het
Rab3il1	G	A	19: 10,026,777	A18T	probably damaging	Het
Sbf2	A	T	7: 110,329,862	S1471T	probably damaging	Het
Setdb1	T	A	3: 95,356,060	D45V	probably damaging	Het
Sik3	G	T	9: 46,178,513	V275L	probably benign	Het
Skint6	C	A	4: 112,988,952	M659I	probably benign	Het
Slc24a1	T	A	9: 64,928,703	D714V	unknown	Het
Slc26a5	T	A	5: 21,813,882	D653V	probably damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Stradb	A	G	1: 58,994,319	I380M	probably benign	Het
Sult1e1	T	C	5: 87,587,642	Y59C	probably benign	Het
Tas2r122	C	T	6: 132,711,739	A64T	probably benign	Het
Tep1	C	T	14: 50,837,132	C1812Y	probably damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trio	A	T	15: 27,905,225	C152S	unknown	Het
Tro	G	A	X: 150,655,559	S34L	unknown	Het
Vmn1r15	A	G	6: 57,258,138		probably benign	Het
Vmn1r19	A	G	6: 57,404,451		probably benign	Het
Vmn1r75	A	G	7: 11,880,703	T121A	possibly damaging	Het
Vmn2r32	A	G	7: 7,474,670	F241L	probably damaging	Het
Vmn2r66	A	G	7: 85,005,685	L472P	probably damaging	Het
Ylpm1	G	T	12: 84,996,792	W101C	unknown	Het
Zdbf2	C	A	1: 63,308,113	H1884N	probably benign	Het

Other mutations in Gon4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00870:Gon4l	APN	3	88857185	missense	probably damaging	1.00
IGL02002:Gon4l	APN	3	88895336	missense	possibly damaging	0.46
IGL02065:Gon4l	APN	3	88857210	missense	probably null	1.00
IGL02283:Gon4l	APN	3	88895364	missense	probably damaging	0.99
IGL02669:Gon4l	APN	3	88895499	missense	probably damaging	1.00
IGL03222:Gon4l	APN	3	88895643	missense	possibly damaging	0.56
IGL03385:Gon4l	APN	3	88907543	missense	probably benign	0.10
PIT4581001:Gon4l	UTSW	3	88895514	missense	probably damaging	1.00
R0020:Gon4l	UTSW	3	88858937	missense	probably damaging	1.00
R0115:Gon4l	UTSW	3	88895682	missense	probably damaging	1.00
R0173:Gon4l	UTSW	3	88858403	missense	probably damaging	1.00
R0270:Gon4l	UTSW	3	88858400	missense	probably damaging	1.00
R0961:Gon4l	UTSW	3	88898096	splice site	probably benign
R1017:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R1163:Gon4l	UTSW	3	88892535	missense	probably damaging	1.00
R1729:Gon4l	UTSW	3	88903098	missense	probably damaging	1.00
R1764:Gon4l	UTSW	3	88892599	missense	probably damaging	1.00
R1861:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R2141:Gon4l	UTSW	3	88887595	missense	possibly damaging	0.66
R2347:Gon4l	UTSW	3	88863517	missense	probably damaging	1.00
R2402:Gon4l	UTSW	3	88859043	missense	probably damaging	1.00
R2842:Gon4l	UTSW	3	88895487	missense	probably damaging	1.00
R4375:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4376:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4377:Gon4l	UTSW	3	88907387	missense	probably benign	0.00
R4569:Gon4l	UTSW	3	88910090	intron	probably benign
R4650:Gon4l	UTSW	3	88863552	missense	possibly damaging	0.94
R4859:Gon4l	UTSW	3	88895348	missense	probably benign	0.00
R4901:Gon4l	UTSW	3	88908151	missense	possibly damaging	0.50
R4998:Gon4l	UTSW	3	88899998	missense	probably damaging	1.00
R5059:Gon4l	UTSW	3	88900012	missense	probably benign	0.00
R5217:Gon4l	UTSW	3	88887575	missense	probably damaging	1.00
R5269:Gon4l	UTSW	3	88895528	missense	probably benign
R5279:Gon4l	UTSW	3	88887637	missense	probably benign
R5283:Gon4l	UTSW	3	88887590	missense	probably damaging	1.00
R5386:Gon4l	UTSW	3	88858496	missense	probably benign	0.15
R5433:Gon4l	UTSW	3	88896225	missense	possibly damaging	0.93
R5583:Gon4l	UTSW	3	88899971	missense	probably damaging	1.00
R5695:Gon4l	UTSW	3	88896216	frame shift	probably null
R5921:Gon4l	UTSW	3	88909947	intron	probably benign
R6003:Gon4l	UTSW	3	88896093	missense	probably damaging	0.99
R6063:Gon4l	UTSW	3	88899999	missense	probably damaging	1.00
R6217:Gon4l	UTSW	3	88892661	missense	possibly damaging	0.62
R6273:Gon4l	UTSW	3	88855849	missense	probably damaging	1.00
R6280:Gon4l	UTSW	3	88890888	missense	probably damaging	1.00
R6790:Gon4l	UTSW	3	88858998	missense	probably damaging	1.00
R6829:Gon4l	UTSW	3	88880106	missense	possibly damaging	0.96
R6891:Gon4l	UTSW	3	88858866	splice site	probably null
R7128:Gon4l	UTSW	3	88895692	missense	possibly damaging	0.94
R7315:Gon4l	UTSW	3	88895179	missense	probably benign	0.00
R7355:Gon4l	UTSW	3	88863520	missense	probably damaging	1.00
R7426:Gon4l	UTSW	3	88907522	missense	probably benign
R7635:Gon4l	UTSW	3	88895106	missense	probably benign	0.03
R7643:Gon4l	UTSW	3	88902807	missense	probably damaging	1.00
R7715:Gon4l	UTSW	3	88908006	missense	probably benign
R7773:Gon4l	UTSW	3	88895795	missense	probably benign	0.00
R8090:Gon4l	UTSW	3	88892624	missense	probably damaging	1.00
R8224:Gon4l	UTSW	3	88895142	missense	probably damaging	1.00
R8260:Gon4l	UTSW	3	88892630	missense	probably damaging	0.98
R8434:Gon4l	UTSW	3	88854779	missense	probably damaging	1.00
R8732:Gon4l	UTSW	3	88899984	missense	possibly damaging	0.95
R9132:Gon4l	UTSW	3	88908177	missense	probably benign	0.29
R9161:Gon4l	UTSW	3	88901648	missense	probably damaging	1.00
R9187:Gon4l	UTSW	3	88879311	missense	probably benign	0.10
R9212:Gon4l	UTSW	3	88896423	missense	probably benign	0.01
R9338:Gon4l	UTSW	3	88901712	missense	probably benign	0.00
R9387:Gon4l	UTSW	3	88894953	missense	probably benign	0.00
R9416:Gon4l	UTSW	3	88896231	missense	probably benign	0.00
R9607:Gon4l	UTSW	3	88858444	missense	probably damaging	0.99
Z1177:Gon4l	UTSW	3	88859036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACGTCTGCTGTGTTCTAGAGC -3'
(R):5'- GAGGAATCTGGACCACTGTG -3'

Sequencing Primer
(F):5'- GCCAGTCTACAGTCCATTCAGG -3'
(R):5'- AATCTGGACCACTGTGTTGCTTG -3'

Posted On

2021-04-30