Incidental Mutation 'R8812:Skint6'
ID 672470
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 068647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R8812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 112846149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 659 (M659I)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably benign
Transcript: ENSMUST00000138966
AA Change: M659I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: M659I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171224
AA Change: M659I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: M659I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,480,471 (GRCm39) P1167Q probably damaging Het
Abtb3 A G 10: 85,463,113 (GRCm39) Q626R probably damaging Het
Adcy10 A T 1: 165,378,867 (GRCm39) Q885H probably damaging Het
Alkal2 C T 12: 30,940,055 (GRCm39) L139F probably damaging Het
Ankrd17 A T 5: 90,441,062 (GRCm39) M439K probably benign Het
Arl11 C A 14: 61,548,422 (GRCm39) Y77* probably null Het
Bcas3 T C 11: 85,449,973 (GRCm39) Y669H probably benign Het
Bpifb3 C T 2: 153,764,516 (GRCm39) A136V probably benign Het
Ccne2 A G 4: 11,202,279 (GRCm39) T345A probably benign Het
Ciz1 T C 2: 32,254,286 (GRCm39) S76P probably benign Het
Clip4 A T 17: 72,107,800 (GRCm39) K94* probably null Het
Cthrc1 G A 15: 38,947,866 (GRCm39) R195H probably damaging Het
Ddx31 T C 2: 28,730,816 (GRCm39) probably benign Het
Elf2 T A 3: 51,174,188 (GRCm39) D113V possibly damaging Het
Esrrb A G 12: 86,535,324 (GRCm39) N155S probably benign Het
Flnb A G 14: 7,887,624 (GRCm38) D478G probably benign Het
Galm T A 17: 80,435,215 (GRCm39) L24H probably damaging Het
Gask1b T C 3: 79,816,078 (GRCm39) S363P possibly damaging Het
Gon4l G A 3: 88,802,314 (GRCm39) G975D possibly damaging Het
Hspbp1 T G 7: 4,667,783 (GRCm39) M237L probably benign Het
Ighv1-62-1 A T 12: 115,350,367 (GRCm39) M100K probably damaging Het
Ipo8 A T 6: 148,676,575 (GRCm39) D971E possibly damaging Het
Itgax C T 7: 127,732,979 (GRCm39) A286V probably damaging Het
Jpt2 T C 17: 25,179,578 (GRCm39) Q3R probably benign Het
Katnip A C 7: 125,396,867 (GRCm39) R309S probably benign Het
Klrg2 A C 6: 38,613,838 (GRCm39) L55R probably damaging Het
Lrp6 T A 6: 134,433,141 (GRCm39) M1397L probably benign Het
Lrrc31 T A 3: 30,733,328 (GRCm39) Q462L probably benign Het
Lyg2 T A 1: 37,949,054 (GRCm39) I103F probably damaging Het
Map10 T C 8: 126,396,664 (GRCm39) V19A probably damaging Het
Map1b T A 13: 99,569,323 (GRCm39) M1133L unknown Het
Mrgpra4 A G 7: 47,631,481 (GRCm39) V40A probably benign Het
Myh1 G A 11: 67,099,967 (GRCm39) G626R probably benign Het
Myo9a T C 9: 59,687,030 (GRCm39) V45A probably benign Het
Ncdn A G 4: 126,638,905 (GRCm39) F638S possibly damaging Het
Ncs1 T A 2: 31,174,213 (GRCm39) M121K probably damaging Het
Nf1 T C 11: 79,437,180 (GRCm39) V16A probably damaging Het
Nktr T A 9: 121,579,317 (GRCm39) D1128E unknown Het
Nup205 T G 6: 35,191,269 (GRCm39) L1000R probably damaging Het
Obscn T C 11: 58,925,921 (GRCm39) E5604G probably damaging Het
Or1p4-ps1 T A 11: 74,208,534 (GRCm39) S228T unknown Het
Or2p2 T C 13: 21,257,220 (GRCm39) N84D probably damaging Het
Or4a68 A G 2: 89,270,209 (GRCm39) V138A probably benign Het
Or4c35 G T 2: 89,808,715 (GRCm39) A198S possibly damaging Het
Or51ah3 G T 7: 103,209,816 (GRCm39) C44F probably benign Het
Or5b96 A T 19: 12,867,560 (GRCm39) V127E probably damaging Het
Or7g12 A G 9: 18,899,812 (GRCm39) H176R possibly damaging Het
Ovch2 T A 7: 107,392,462 (GRCm39) I294F probably damaging Het
Ovch2 A T 7: 107,393,251 (GRCm39) C207* probably null Het
P3h2 T A 16: 25,801,467 (GRCm39) Y397F possibly damaging Het
Pappa A T 4: 65,123,166 (GRCm39) I834F possibly damaging Het
Pcdha11 T C 18: 37,140,716 (GRCm39) S782P probably benign Het
Pex1 T C 5: 3,681,614 (GRCm39) V980A probably benign Het
Pik3c2a G T 7: 115,951,112 (GRCm39) L1258I probably damaging Het
Pmp22 T A 11: 63,049,239 (GRCm39) *161R probably null Het
Ppp1r26 T A 2: 28,341,192 (GRCm39) M274K probably benign Het
Ppp6r2 T C 15: 89,167,275 (GRCm39) V830A probably benign Het
Pramel34 T C 5: 93,785,660 (GRCm39) T207A possibly damaging Het
Prss1 T A 6: 41,439,520 (GRCm39) N84K probably benign Het
Rab3il1 G A 19: 10,004,141 (GRCm39) A18T probably damaging Het
Sbf2 A T 7: 109,929,069 (GRCm39) S1471T probably damaging Het
Setdb1 T A 3: 95,263,371 (GRCm39) D45V probably damaging Het
Sik3 G T 9: 46,089,811 (GRCm39) V275L probably benign Het
Slc24a1 T A 9: 64,835,985 (GRCm39) D714V unknown Het
Slc26a5 T A 5: 22,018,880 (GRCm39) D653V probably damaging Het
Snrnp27 A T 6: 86,653,196 (GRCm39) C141S probably benign Het
Stradb A G 1: 59,033,478 (GRCm39) I380M probably benign Het
Sult1e1 T C 5: 87,735,501 (GRCm39) Y59C probably benign Het
Tas2r122 C T 6: 132,688,702 (GRCm39) A64T probably benign Het
Tep1 C T 14: 51,074,589 (GRCm39) C1812Y probably damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trio A T 15: 27,905,311 (GRCm39) C152S unknown Het
Tro G A X: 149,438,555 (GRCm39) S34L unknown Het
Vmn1r15 A G 6: 57,235,123 (GRCm39) probably benign Het
Vmn1r19 A G 6: 57,381,436 (GRCm39) probably benign Het
Vmn1r75 A G 7: 11,614,630 (GRCm39) T121A possibly damaging Het
Vmn2r32 A G 7: 7,477,669 (GRCm39) F241L probably damaging Het
Vmn2r66 A G 7: 84,654,893 (GRCm39) L472P probably damaging Het
Ylpm1 G T 12: 85,043,566 (GRCm39) W101C unknown Het
Zdbf2 C A 1: 63,347,272 (GRCm39) H1884N probably benign Het
Zfp1005 T A 2: 150,109,624 (GRCm39) C105S possibly damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCTTGGTAAAGGTCCCTTCCC -3'
(R):5'- GTCCACACAACAAAATGTAGAGGTT -3'

Sequencing Primer
(F):5'- AGTAGTTCTGCCCTAGACCTAGAG -3'
(R):5'- TGTTTCTTCTCAGCCAGGAAAG -3'
Posted On 2021-04-30