Mutagenetix > Incidental Mutation

Incidental Mutation 'R8812:Ankrd17'

672475

Institutional Source

Beutler Lab

Gene Symbol

Ankrd17

Ensembl Gene

ENSMUSG00000055204

Gene Name

ankyrin repeat domain 17

Synonyms

A130069E23Rik, 4933425K22Rik, Gtar

MMRRC Submission

Accession Numbers

Genbank: NM_030886, NM_198010; MGI: 1932101

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8812 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90227166-90366577 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90293203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 439 (M439K)

Ref Sequence

ENSEMBL: ENSMUSP00000014421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014421] [ENSMUST00000081914] [ENSMUST00000168058] [ENSMUST00000197021] [ENSMUST00000218526]

AlphaFold

Q99NH0

Predicted Effect

probably benign
Transcript: ENSMUST00000014421
AA Change: M439K

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000014421
Gene: ENSMUSG00000055204
AA Change: M439K

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
coiled coil region	800	883	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC
low complexity region	955	968	N/A	INTRINSIC
low complexity region	986	997	N/A	INTRINSIC
low complexity region	1046	1060	N/A	INTRINSIC
ANK	1078	1107	2.13e-4	SMART
ANK	1111	1140	8.19e-6	SMART
ANK	1145	1174	1.68e-2	SMART
ANK	1178	1207	1.61e-4	SMART
ANK	1213	1242	1.43e-5	SMART
ANK	1247	1276	1.83e-3	SMART
ANK	1280	1309	3.91e-3	SMART
ANK	1315	1344	1.93e-2	SMART
ANK	1348	1377	8.78e-6	SMART
ANK	1381	1410	7.59e-1	SMART
coiled coil region	1454	1522	N/A	INTRINSIC
low complexity region	1597	1611	N/A	INTRINSIC
low complexity region	1616	1636	N/A	INTRINSIC
KH	1720	1790	8.31e-14	SMART
low complexity region	1816	1827	N/A	INTRINSIC
low complexity region	1834	1850	N/A	INTRINSIC
low complexity region	1946	1989	N/A	INTRINSIC
low complexity region	1996	2024	N/A	INTRINSIC
low complexity region	2035	2052	N/A	INTRINSIC
low complexity region	2068	2077	N/A	INTRINSIC
low complexity region	2086	2110	N/A	INTRINSIC
low complexity region	2175	2189	N/A	INTRINSIC
low complexity region	2348	2365	N/A	INTRINSIC
low complexity region	2392	2411	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081914
AA Change: M439K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000080587
Gene: ENSMUSG00000055204
AA Change: M439K

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
low complexity region	795	809	N/A	INTRINSIC
ANK	827	856	2.13e-4	SMART
ANK	860	889	8.19e-6	SMART
ANK	894	923	1.68e-2	SMART
ANK	927	956	1.61e-4	SMART
ANK	962	991	1.43e-5	SMART
ANK	996	1025	1.83e-3	SMART
ANK	1029	1058	3.91e-3	SMART
ANK	1064	1093	1.93e-2	SMART
ANK	1097	1126	8.78e-6	SMART
ANK	1130	1159	7.59e-1	SMART
coiled coil region	1203	1271	N/A	INTRINSIC
low complexity region	1346	1360	N/A	INTRINSIC
low complexity region	1365	1385	N/A	INTRINSIC
KH	1469	1539	8.31e-14	SMART
low complexity region	1565	1576	N/A	INTRINSIC
low complexity region	1583	1599	N/A	INTRINSIC
low complexity region	1695	1738	N/A	INTRINSIC
low complexity region	1745	1773	N/A	INTRINSIC
low complexity region	1784	1801	N/A	INTRINSIC
low complexity region	1817	1826	N/A	INTRINSIC
low complexity region	1835	1859	N/A	INTRINSIC
low complexity region	1924	1938	N/A	INTRINSIC
low complexity region	2097	2114	N/A	INTRINSIC
low complexity region	2141	2160	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000128960
Gene: ENSMUSG00000055204
AA Change: M439K

Domain	Start	End	E-Value	Type
low complexity region	6	40	N/A	INTRINSIC
low complexity region	55	71	N/A	INTRINSIC
low complexity region	82	130	N/A	INTRINSIC
ANK	229	258	8.62e1	SMART
ANK	262	291	3.31e-1	SMART
ANK	296	325	3.51e-5	SMART
ANK	329	358	1.33e-5	SMART
ANK	362	391	3.46e-4	SMART
ANK	396	425	3.23e-4	SMART
ANK	429	458	1.61e-4	SMART
ANK	462	491	1.46e-2	SMART
ANK	495	524	3.88e-7	SMART
ANK	529	558	4.19e-3	SMART
ANK	559	588	1.76e-5	SMART
ANK	592	621	3.51e-5	SMART
ANK	625	654	5.62e-4	SMART
ANK	659	688	1.29e-3	SMART
ANK	692	721	1.44e-1	SMART
coiled coil region	800	883	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC
low complexity region	955	968	N/A	INTRINSIC
low complexity region	986	997	N/A	INTRINSIC
low complexity region	1046	1060	N/A	INTRINSIC
ANK	1078	1107	2.13e-4	SMART
ANK	1111	1140	8.19e-6	SMART
ANK	1145	1174	1.68e-2	SMART
ANK	1178	1207	1.61e-4	SMART
ANK	1213	1242	1.43e-5	SMART
ANK	1247	1276	1.83e-3	SMART
ANK	1280	1309	3.91e-3	SMART
ANK	1315	1344	1.93e-2	SMART
ANK	1348	1377	8.78e-6	SMART
ANK	1381	1410	7.59e-1	SMART
coiled coil region	1454	1522	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000197021
AA Change: M330K

SMART Domains

Protein: ENSMUSP00000142575
Gene: ENSMUSG00000055204
AA Change: M330K

Domain	Start	End	E-Value	Type
ANK	120	149	5.4e-1	SMART
ANK	153	182	2e-3	SMART
ANK	187	216	2.2e-7	SMART
ANK	220	249	8.2e-8	SMART
ANK	253	282	2.2e-6	SMART
ANK	287	316	2.1e-6	SMART
ANK	320	349	9.9e-7	SMART
ANK	353	382	9.5e-5	SMART
ANK	386	415	2.4e-9	SMART
ANK	420	449	2.6e-5	SMART
ANK	450	479	1.1e-7	SMART
ANK	483	512	2.2e-7	SMART
ANK	516	545	3.5e-6	SMART
ANK	550	579	7.9e-6	SMART
ANK	583	612	8.9e-4	SMART
coiled coil region	691	774	N/A	INTRINSIC
low complexity region	781	794	N/A	INTRINSIC
low complexity region	846	859	N/A	INTRINSIC
low complexity region	877	888	N/A	INTRINSIC
low complexity region	937	951	N/A	INTRINSIC
ANK	969	998	1.4e-6	SMART
ANK	1002	1031	5.3e-8	SMART
ANK	1036	1065	1e-4	SMART
ANK	1069	1098	1e-6	SMART
ANK	1104	1133	9.1e-8	SMART
ANK	1138	1167	1.2e-5	SMART
ANK	1171	1200	2.5e-5	SMART
ANK	1206	1235	1.2e-4	SMART
ANK	1239	1268	5.5e-8	SMART
ANK	1272	1301	4.7e-3	SMART
coiled coil region	1345	1413	N/A	INTRINSIC
low complexity region	1488	1502	N/A	INTRINSIC
low complexity region	1507	1527	N/A	INTRINSIC
KH	1611	1681	5.1e-16	SMART
low complexity region	1707	1718	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1837	1880	N/A	INTRINSIC
low complexity region	1887	1915	N/A	INTRINSIC
low complexity region	1926	1943	N/A	INTRINSIC
low complexity region	1959	1968	N/A	INTRINSIC
low complexity region	1977	2001	N/A	INTRINSIC
low complexity region	2066	2080	N/A	INTRINSIC
low complexity region	2239	2256	N/A	INTRINSIC
low complexity region	2283	2302	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000218526
AA Change: M439K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

Strain: 4360512
Lethality: E10-E12
FUNCTION: This gene encodes a protein with ankyrin repeats, which are associated with protein-protein interactions. Studies suggest that this protein is involved in liver development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with hemorrhages, impaired vascular smooth muscle cell development, impaired vascular integrity, and growth retardation. [provided by MGI curators]

Allele List at MGI

All alleles(133) : Targeted(4) Gene trapped(129)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	A	13: 77,332,352	P1167Q	probably damaging	Het
Adcy10	A	T	1: 165,551,298	Q885H	probably damaging	Het
Alkal2	C	T	12: 30,890,056	L139F	probably damaging	Het
Arl11	C	A	14: 61,310,973	Y77*	probably null	Het
Bcas3	T	C	11: 85,559,147	Y669H	probably benign	Het
Bpifb3	C	T	2: 153,922,596	A136V	probably benign	Het
Btbd11	A	G	10: 85,627,249	Q626R	probably damaging	Het
C87414	T	C	5: 93,637,801	T207A	possibly damaging	Het
Ccne2	A	G	4: 11,202,279	T345A	probably benign	Het
Ciz1	T	C	2: 32,364,274	S76P	probably benign	Het
Clip4	A	T	17: 71,800,805	K94*	probably null	Het
Cthrc1	G	A	15: 39,084,471	R195H	probably damaging	Het
D430042O09Rik	A	C	7: 125,797,695	R309S	probably benign	Het
Ddx31	T	C	2: 28,840,804		probably benign	Het
Elf2	T	A	3: 51,266,767	D113V	possibly damaging	Het
Esrrb	A	G	12: 86,488,550	N155S	probably benign	Het
Fam198b	T	C	3: 79,908,771	S363P	possibly damaging	Het
Flnb	A	G	14: 7,887,624	D478G	probably benign	Het
Galm	T	A	17: 80,127,786	L24H	probably damaging	Het
Gm14124	T	A	2: 150,267,704	C105S	possibly damaging	Het
Gon4l	G	A	3: 88,895,007	G975D	possibly damaging	Het
Hspbp1	T	G	7: 4,664,784	M237L	probably benign	Het
Ighv1-62-1	A	T	12: 115,386,747	M100K	probably damaging	Het
Ipo8	A	T	6: 148,775,077	D971E	possibly damaging	Het
Itgax	C	T	7: 128,133,807	A286V	probably damaging	Het
Jpt2	T	C	17: 24,960,604	Q3R	probably benign	Het
Klrg2	A	C	6: 38,636,903	L55R	probably damaging	Het
Lrp6	T	A	6: 134,456,178	M1397L	probably benign	Het
Lrrc31	T	A	3: 30,679,179	Q462L	probably benign	Het
Lyg2	T	A	1: 37,909,973	I103F	probably damaging	Het
Map10	T	C	8: 125,669,925	V19A	probably damaging	Het
Map1b	T	A	13: 99,432,815	M1133L	unknown	Het
Mrgpra4	A	G	7: 47,981,733	V40A	probably benign	Het
Myh1	G	A	11: 67,209,141	G626R	probably benign	Het
Myo9a	T	C	9: 59,779,747	V45A	probably benign	Het
Ncdn	A	G	4: 126,745,112	F638S	possibly damaging	Het
Ncs1	T	A	2: 31,284,201	M121K	probably damaging	Het
Nf1	T	C	11: 79,546,354	V16A	probably damaging	Het
Nktr	T	A	9: 121,750,251	D1128E	unknown	Het
Nup205	T	G	6: 35,214,334	L1000R	probably damaging	Het
Obscn	T	C	11: 59,035,095	E5604G	probably damaging	Het
Olfr1240	A	G	2: 89,439,865	V138A	probably benign	Het
Olfr1260	G	T	2: 89,978,371	A198S	possibly damaging	Het
Olfr1370	T	C	13: 21,073,050	N84D	probably damaging	Het
Olfr1446	A	T	19: 12,890,196	V127E	probably damaging	Het
Olfr409-ps1	T	A	11: 74,317,708	S228T	unknown	Het
Olfr615	G	T	7: 103,560,609	C44F	probably benign	Het
Olfr834	A	G	9: 18,988,516	H176R	possibly damaging	Het
Ovch2	T	A	7: 107,793,255	I294F	probably damaging	Het
Ovch2	A	T	7: 107,794,044	C207*	probably null	Het
P3h2	T	A	16: 25,982,717	Y397F	possibly damaging	Het
Pappa	A	T	4: 65,204,929	I834F	possibly damaging	Het
Pcdha11	T	C	18: 37,007,663	S782P	probably benign	Het
Pex1	T	C	5: 3,631,614	V980A	probably benign	Het
Pik3c2a	G	T	7: 116,351,877	L1258I	probably damaging	Het
Pmp22	T	A	11: 63,158,413	*161R	probably null	Het
Ppp1r26	T	A	2: 28,451,180	M274K	probably benign	Het
Ppp6r2	T	C	15: 89,283,072	V830A	probably benign	Het
Prss1	T	A	6: 41,462,586	N84K	probably benign	Het
Rab3il1	G	A	19: 10,026,777	A18T	probably damaging	Het
Sbf2	A	T	7: 110,329,862	S1471T	probably damaging	Het
Setdb1	T	A	3: 95,356,060	D45V	probably damaging	Het
Sik3	G	T	9: 46,178,513	V275L	probably benign	Het
Skint6	C	A	4: 112,988,952	M659I	probably benign	Het
Slc24a1	T	A	9: 64,928,703	D714V	unknown	Het
Slc26a5	T	A	5: 21,813,882	D653V	probably damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Stradb	A	G	1: 58,994,319	I380M	probably benign	Het
Sult1e1	T	C	5: 87,587,642	Y59C	probably benign	Het
Tas2r122	C	T	6: 132,711,739	A64T	probably benign	Het
Tep1	C	T	14: 50,837,132	C1812Y	probably damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trio	A	T	15: 27,905,225	C152S	unknown	Het
Tro	G	A	X: 150,655,559	S34L	unknown	Het
Vmn1r15	A	G	6: 57,258,138		probably benign	Het
Vmn1r19	A	G	6: 57,404,451		probably benign	Het
Vmn1r75	A	G	7: 11,880,703	T121A	possibly damaging	Het
Vmn2r32	A	G	7: 7,474,670	F241L	probably damaging	Het
Vmn2r66	A	G	7: 85,005,685	L472P	probably damaging	Het
Ylpm1	G	T	12: 84,996,792	W101C	unknown	Het
Zdbf2	C	A	1: 63,308,113	H1884N	probably benign	Het

Other mutations in Ankrd17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ankrd17	APN	5	90233928	missense	probably damaging	0.98
IGL00484:Ankrd17	APN	5	90268361	missense	probably damaging	0.99
IGL01320:Ankrd17	APN	5	90260129	missense	probably damaging	0.99
IGL01776:Ankrd17	APN	5	90283364	nonsense	probably null
IGL02093:Ankrd17	APN	5	90242963	missense	possibly damaging	0.93
IGL02292:Ankrd17	APN	5	90252859	unclassified	probably benign
IGL02302:Ankrd17	APN	5	90283198	missense	probably benign	0.23
IGL02472:Ankrd17	APN	5	90264151	missense	probably damaging	1.00
IGL02705:Ankrd17	APN	5	90283115	missense	probably benign	0.15
IGL02727:Ankrd17	APN	5	90244292	missense	possibly damaging	0.93
IGL02884:Ankrd17	APN	5	90264757	missense	probably damaging	1.00
3-1:Ankrd17	UTSW	5	90243154	missense	probably damaging	0.99
PIT1430001:Ankrd17	UTSW	5	90252973	missense	possibly damaging	0.91
R0025:Ankrd17	UTSW	5	90250405	missense	probably damaging	0.99
R0076:Ankrd17	UTSW	5	90244406	nonsense	probably null
R0076:Ankrd17	UTSW	5	90244406	nonsense	probably null
R0271:Ankrd17	UTSW	5	90254799	missense	possibly damaging	0.90
R0684:Ankrd17	UTSW	5	90263998	missense	probably damaging	0.99
R1239:Ankrd17	UTSW	5	90288676	missense	probably damaging	0.99
R1457:Ankrd17	UTSW	5	90285846	missense	possibly damaging	0.92
R1505:Ankrd17	UTSW	5	90300026	missense	possibly damaging	0.53
R1766:Ankrd17	UTSW	5	90264797	missense	possibly damaging	0.95
R1770:Ankrd17	UTSW	5	90243376	missense	possibly damaging	0.84
R1780:Ankrd17	UTSW	5	90232415	missense	probably damaging	0.96
R1916:Ankrd17	UTSW	5	90260141	missense	probably damaging	1.00
R1926:Ankrd17	UTSW	5	90244169	missense	probably damaging	1.00
R2090:Ankrd17	UTSW	5	90298046	missense	possibly damaging	0.92
R2153:Ankrd17	UTSW	5	90234059	missense	probably damaging	0.98
R2279:Ankrd17	UTSW	5	90264717	missense	probably damaging	1.00
R2420:Ankrd17	UTSW	5	90289320	missense	possibly damaging	0.94
R3012:Ankrd17	UTSW	5	90230868	missense	probably damaging	1.00
R3417:Ankrd17	UTSW	5	90243913	missense	possibly damaging	0.86
R3704:Ankrd17	UTSW	5	90243969	missense	possibly damaging	0.72
R4581:Ankrd17	UTSW	5	90283120	missense	possibly damaging	0.67
R4850:Ankrd17	UTSW	5	90264786	missense	probably damaging	1.00
R4926:Ankrd17	UTSW	5	90300032	missense	probably damaging	1.00
R5023:Ankrd17	UTSW	5	90282868	missense	probably damaging	1.00
R5068:Ankrd17	UTSW	5	90254808	missense	probably damaging	0.96
R5109:Ankrd17	UTSW	5	90243536	missense	possibly damaging	0.83
R5111:Ankrd17	UTSW	5	90242999	missense	possibly damaging	0.85
R5214:Ankrd17	UTSW	5	90283460	missense	possibly damaging	0.48
R5362:Ankrd17	UTSW	5	90265545	missense	probably damaging	1.00
R5576:Ankrd17	UTSW	5	90243224	missense	probably benign	0.00
R5615:Ankrd17	UTSW	5	90283436	missense	possibly damaging	0.88
R5874:Ankrd17	UTSW	5	90268797	intron	probably benign
R5932:Ankrd17	UTSW	5	90265436	missense	probably damaging	1.00
R5944:Ankrd17	UTSW	5	90285843	missense	probably damaging	1.00
R5993:Ankrd17	UTSW	5	90339672	intron	probably benign
R6052:Ankrd17	UTSW	5	90253832	missense	probably benign	0.03
R6088:Ankrd17	UTSW	5	90253688	missense	possibly damaging	0.95
R6306:Ankrd17	UTSW	5	90244154	missense	probably benign	0.03
R6418:Ankrd17	UTSW	5	90278345	missense	possibly damaging	0.89
R6663:Ankrd17	UTSW	5	90264064	missense	probably damaging	1.00
R6758:Ankrd17	UTSW	5	90263313	missense	probably damaging	1.00
R6782:Ankrd17	UTSW	5	90254738	missense	possibly damaging	0.91
R6793:Ankrd17	UTSW	5	90265512	missense	probably damaging	1.00
R6929:Ankrd17	UTSW	5	90285525	missense	possibly damaging	0.86
R7008:Ankrd17	UTSW	5	90260096	missense	possibly damaging	0.93
R7051:Ankrd17	UTSW	5	90366451	unclassified	probably benign
R7077:Ankrd17	UTSW	5	90285864	missense	possibly damaging	0.92
R7134:Ankrd17	UTSW	5	90232314	missense	probably damaging	0.99
R7134:Ankrd17	UTSW	5	90285523	missense	probably benign	0.03
R7138:Ankrd17	UTSW	5	90242977	missense	probably benign	0.38
R7143:Ankrd17	UTSW	5	90285961	missense	possibly damaging	0.85
R7173:Ankrd17	UTSW	5	90260117	missense	possibly damaging	0.95
R7176:Ankrd17	UTSW	5	90268735	missense	probably damaging	0.99
R7365:Ankrd17	UTSW	5	90291151	missense	possibly damaging	0.45
R7390:Ankrd17	UTSW	5	90282920	missense	probably benign	0.13
R7430:Ankrd17	UTSW	5	90295657	missense	possibly damaging	0.80
R7468:Ankrd17	UTSW	5	90243043	missense	probably benign
R7483:Ankrd17	UTSW	5	90299996	missense	probably benign	0.00
R7492:Ankrd17	UTSW	5	90233948	missense	possibly damaging	0.85
R7610:Ankrd17	UTSW	5	90232363	missense	possibly damaging	0.93
R7636:Ankrd17	UTSW	5	90232380	missense	possibly damaging	0.53
R7790:Ankrd17	UTSW	5	90260152	missense	possibly damaging	0.61
R7839:Ankrd17	UTSW	5	90263354	missense	probably damaging	0.97
R7853:Ankrd17	UTSW	5	90238966	missense	possibly damaging	0.91
R7976:Ankrd17	UTSW	5	90283592	nonsense	probably null
R8054:Ankrd17	UTSW	5	90291055	missense	probably benign	0.43
R8230:Ankrd17	UTSW	5	90243976	missense	possibly damaging	0.86
R8274:Ankrd17	UTSW	5	90282859	missense	probably benign	0.15
R8365:Ankrd17	UTSW	5	90250519	missense	possibly damaging	0.95
R8532:Ankrd17	UTSW	5	90264820	missense	probably damaging	1.00
R8729:Ankrd17	UTSW	5	90295593	missense	probably benign
R8933:Ankrd17	UTSW	5	90258466	missense	probably damaging	0.99
R9051:Ankrd17	UTSW	5	90263275	missense	probably damaging	0.99
R9055:Ankrd17	UTSW	5	90232309	missense	probably benign	0.33
R9136:Ankrd17	UTSW	5	90244419	missense	probably damaging	0.96
R9158:Ankrd17	UTSW	5	90268716	missense	probably damaging	1.00
R9201:Ankrd17	UTSW	5	90230939	missense	possibly damaging	0.84
R9315:Ankrd17	UTSW	5	90250501	missense	probably damaging	0.97
R9364:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9366:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9368:Ankrd17	UTSW	5	90244127	missense	possibly damaging	0.91
R9368:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9369:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9381:Ankrd17	UTSW	5	90268649	missense	probably damaging	1.00
R9570:Ankrd17	UTSW	5	90253677	missense
X0019:Ankrd17	UTSW	5	90298654	missense	probably damaging	1.00
Z1177:Ankrd17	UTSW	5	90283505	missense	possibly damaging	0.83
Z1177:Ankrd17	UTSW	5	90289325	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- ATGCGTGCATGTATATACACAC -3'
(R):5'- TGAGATGTTGGGACGTGACATC -3'

Sequencing Primer
(F):5'- TGTCCTGAAACTCACTATGGGCAG -3'
(R):5'- GACGTGACATCTTTGTTTATTTGCAC -3'

Posted On

2021-04-30