Incidental Mutation 'R8812:Ipo8'
ID 672485
Institutional Source Beutler Lab
Gene Symbol Ipo8
Ensembl Gene ENSMUSG00000040029
Gene Name importin 8
Synonyms OM-1, Om1, C130009K11Rik, Ranbp8, 6230418K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 148770683-148831467 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 148775077 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 971 (D971E)
Ref Sequence ENSEMBL: ENSMUSP00000046759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048418]
AlphaFold Q7TMY7
Predicted Effect possibly damaging
Transcript: ENSMUST00000048418
AA Change: D971E

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046759
Gene: ENSMUSG00000040029
AA Change: D971E

DomainStartEndE-ValueType
IBN_N 22 102 1.59e-13 SMART
Pfam:Cse1 166 470 6.6e-11 PFAM
low complexity region 895 908 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. This protein binds to the nuclear pore complex and, along with RanGTP and RANBP1, inhibits the GAP stimulation of the Ran GTPase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Ipo8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ipo8 APN 6 148782786 missense possibly damaging 0.77
IGL01012:Ipo8 APN 6 148789063 splice site probably benign
IGL01124:Ipo8 APN 6 148777376 missense probably benign
IGL01978:Ipo8 APN 6 148777289 missense probably benign 0.25
IGL02111:Ipo8 APN 6 148799780 missense probably damaging 1.00
IGL02193:Ipo8 APN 6 148777284 missense probably damaging 0.96
IGL02589:Ipo8 APN 6 148809907 missense probably damaging 0.98
IGL02690:Ipo8 APN 6 148777363 missense probably benign
IGL02724:Ipo8 APN 6 148791481 nonsense probably null
IGL02935:Ipo8 APN 6 148789841 missense probably benign 0.03
IGL03027:Ipo8 APN 6 148777239 missense probably benign 0.01
IGL03065:Ipo8 APN 6 148784707 missense probably benign 0.44
IGL03338:Ipo8 APN 6 148800257 missense probably benign 0.01
important UTSW 6 148816497 nonsense probably null
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0032:Ipo8 UTSW 6 148810711 missense probably damaging 0.99
R0088:Ipo8 UTSW 6 148801936 missense probably benign 0.27
R0373:Ipo8 UTSW 6 148775042 missense probably benign 0.00
R0539:Ipo8 UTSW 6 148818108 missense probably benign 0.00
R0565:Ipo8 UTSW 6 148786723 missense probably damaging 1.00
R0660:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0664:Ipo8 UTSW 6 148800213 missense probably benign 0.02
R0791:Ipo8 UTSW 6 148821727 missense possibly damaging 0.94
R0989:Ipo8 UTSW 6 148796682 missense probably benign 0.38
R1416:Ipo8 UTSW 6 148789093 missense probably benign
R1417:Ipo8 UTSW 6 148818052 missense probably benign 0.02
R1590:Ipo8 UTSW 6 148810665 splice site probably null
R1703:Ipo8 UTSW 6 148789892 missense probably benign 0.00
R1709:Ipo8 UTSW 6 148782728 missense probably benign
R2079:Ipo8 UTSW 6 148789162 missense probably damaging 1.00
R2338:Ipo8 UTSW 6 148789823 missense probably benign 0.00
R2359:Ipo8 UTSW 6 148816477 splice site probably benign
R2696:Ipo8 UTSW 6 148796741 missense probably benign 0.01
R3407:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3408:Ipo8 UTSW 6 148821709 missense probably benign 0.03
R3709:Ipo8 UTSW 6 148806344 splice site probably null
R3710:Ipo8 UTSW 6 148806344 splice site probably null
R3945:Ipo8 UTSW 6 148818117 missense probably damaging 1.00
R4326:Ipo8 UTSW 6 148800164 unclassified probably benign
R4329:Ipo8 UTSW 6 148800164 unclassified probably benign
R6105:Ipo8 UTSW 6 148798670 missense probably damaging 1.00
R6148:Ipo8 UTSW 6 148799780 missense probably damaging 1.00
R6359:Ipo8 UTSW 6 148777250 missense probably benign 0.01
R6377:Ipo8 UTSW 6 148816497 nonsense probably null
R6724:Ipo8 UTSW 6 148809975 splice site probably null
R7283:Ipo8 UTSW 6 148824481 missense possibly damaging 0.86
R7436:Ipo8 UTSW 6 148789805 missense probably benign 0.13
R7445:Ipo8 UTSW 6 148789817 missense probably benign 0.09
R8044:Ipo8 UTSW 6 148809923 missense probably damaging 1.00
R8209:Ipo8 UTSW 6 148796678 missense possibly damaging 0.93
R8943:Ipo8 UTSW 6 148775049 missense probably benign 0.00
R9067:Ipo8 UTSW 6 148777232 missense probably damaging 1.00
R9129:Ipo8 UTSW 6 148798627 missense probably benign 0.05
R9297:Ipo8 UTSW 6 148801578 missense possibly damaging 0.63
R9419:Ipo8 UTSW 6 148784566 missense probably benign 0.15
Z1177:Ipo8 UTSW 6 148796712 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAAGGGCTCATTTCATGAAGCC -3'
(R):5'- TCCTTGGGGCTCCTCATAGTTG -3'

Sequencing Primer
(F):5'- GCCATTTTAATCACGTAAGCCAG -3'
(R):5'- CCTCATAGTTGGGTATCAAGTAGGCC -3'
Posted On 2021-04-30