Incidental Mutation 'R8812:Vmn2r66'
ID 672490
Institutional Source Beutler Lab
Gene Symbol Vmn2r66
Ensembl Gene ENSMUSG00000094950
Gene Name vomeronasal 2, receptor 66
Synonyms F830104D24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 84994645-85012020 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85005685 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 472 (L472P)
Ref Sequence ENSEMBL: ENSMUSP00000122645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124773]
AlphaFold A0A3B2W842
Predicted Effect probably damaging
Transcript: ENSMUST00000124773
AA Change: L472P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: L472P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 5e-31 PFAM
Pfam:NCD3G 507 559 6e-21 PFAM
Pfam:7tm_3 589 827 3.8e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Vmn2r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Vmn2r66 APN 7 85007091 missense probably benign
IGL01562:Vmn2r66 APN 7 85007287 missense probably benign 0.03
IGL01689:Vmn2r66 APN 7 85007825 missense probably damaging 1.00
IGL02237:Vmn2r66 APN 7 84994700 missense probably benign
IGL02415:Vmn2r66 APN 7 85006812 missense probably damaging 0.97
IGL02439:Vmn2r66 APN 7 85005247 splice site probably benign
IGL02545:Vmn2r66 APN 7 85006590 missense possibly damaging 0.50
IGL02708:Vmn2r66 APN 7 85006588 missense probably benign 0.00
IGL02794:Vmn2r66 APN 7 84995415 missense probably benign 0.00
IGL02885:Vmn2r66 APN 7 84995515 missense probably benign 0.00
IGL02975:Vmn2r66 APN 7 85006974 missense probably damaging 0.98
IGL03027:Vmn2r66 APN 7 84995569 splice site probably benign
IGL03081:Vmn2r66 APN 7 85007930 missense probably benign
PIT4131001:Vmn2r66 UTSW 7 84995093 missense probably damaging 1.00
R0098:Vmn2r66 UTSW 7 85005757 missense probably damaging 1.00
R0504:Vmn2r66 UTSW 7 85006815 missense probably damaging 0.99
R0557:Vmn2r66 UTSW 7 84994764 missense probably damaging 1.00
R0617:Vmn2r66 UTSW 7 84995276 missense probably benign 0.02
R0883:Vmn2r66 UTSW 7 85007862 missense probably benign
R1159:Vmn2r66 UTSW 7 84995405 missense probably benign 0.44
R1168:Vmn2r66 UTSW 7 85006854 missense possibly damaging 0.46
R1172:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1175:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1538:Vmn2r66 UTSW 7 84994958 missense possibly damaging 0.84
R1658:Vmn2r66 UTSW 7 85007747 missense probably benign 0.07
R1937:Vmn2r66 UTSW 7 84995136 missense probably damaging 0.99
R1989:Vmn2r66 UTSW 7 85011993 missense probably benign 0.01
R2698:Vmn2r66 UTSW 7 84995399 missense probably damaging 1.00
R2890:Vmn2r66 UTSW 7 85011819 splice site probably null
R3686:Vmn2r66 UTSW 7 84995189 missense probably damaging 0.96
R4152:Vmn2r66 UTSW 7 85005592 missense probably benign 0.08
R4500:Vmn2r66 UTSW 7 85007954 missense probably damaging 1.00
R4618:Vmn2r66 UTSW 7 84995088 missense possibly damaging 0.62
R4656:Vmn2r66 UTSW 7 85011996 missense possibly damaging 0.87
R4668:Vmn2r66 UTSW 7 84994697 missense probably damaging 1.00
R4942:Vmn2r66 UTSW 7 85007772 missense probably damaging 1.00
R5163:Vmn2r66 UTSW 7 85006809 missense probably benign 0.01
R5223:Vmn2r66 UTSW 7 85007885 missense probably benign
R5377:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R5512:Vmn2r66 UTSW 7 85007941 missense probably damaging 1.00
R5611:Vmn2r66 UTSW 7 85005743 nonsense probably null
R5749:Vmn2r66 UTSW 7 85006771 nonsense probably null
R6131:Vmn2r66 UTSW 7 84995016 missense probably damaging 1.00
R6183:Vmn2r66 UTSW 7 84995558 missense possibly damaging 0.81
R6509:Vmn2r66 UTSW 7 85006846 missense probably benign 0.12
R6930:Vmn2r66 UTSW 7 85012008 missense possibly damaging 0.80
R6992:Vmn2r66 UTSW 7 85005228 missense possibly damaging 0.90
R7015:Vmn2r66 UTSW 7 84995558 missense possibly damaging 0.81
R7302:Vmn2r66 UTSW 7 85005215 missense probably benign 0.00
R7516:Vmn2r66 UTSW 7 85011968 missense possibly damaging 0.51
R7763:Vmn2r66 UTSW 7 85005701 missense probably benign 0.01
R7814:Vmn2r66 UTSW 7 85007264 missense probably benign 0.02
R8077:Vmn2r66 UTSW 7 85006885 missense probably benign
R8307:Vmn2r66 UTSW 7 85007062 missense probably benign
R8315:Vmn2r66 UTSW 7 84994724 missense possibly damaging 0.90
R8490:Vmn2r66 UTSW 7 85005586 critical splice donor site probably null
R8511:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R8781:Vmn2r66 UTSW 7 84995147 nonsense probably null
R9203:Vmn2r66 UTSW 7 85005742 missense probably benign 0.01
R9277:Vmn2r66 UTSW 7 85011956 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCCACTGAAAGACCTCATTTAAG -3'
(R):5'- TAGGTTTTAGAGTACCAAATGCAGG -3'

Sequencing Primer
(F):5'- CTAGGACTCTGTAAAGTCAAT -3'
(R):5'- CAGTGGAGATATATTTACACCTAC -3'
Posted On 2021-04-30