Incidental Mutation 'R8812:Or51ah3'
ID 672491
Institutional Source Beutler Lab
Gene Symbol Or51ah3
Ensembl Gene ENSMUSG00000073947
Gene Name olfactory receptor family 51 subfamily AH member 3
Synonyms MOR19-2, GA_x6K02T2PBJ9-6284902-6285843, Olfr615
MMRRC Submission 068647-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103209686-103210627 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 103209816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 44 (C44F)
Ref Sequence ENSEMBL: ENSMUSP00000148872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
AlphaFold Q8VGY4
Predicted Effect probably benign
Transcript: ENSMUST00000098198
AA Change: C44F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947
AA Change: C44F

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106886
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214345
AA Change: C44F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000214806
Predicted Effect probably benign
Transcript: ENSMUST00000215673
AA Change: C44F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000217293
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,480,471 (GRCm39) P1167Q probably damaging Het
Abtb3 A G 10: 85,463,113 (GRCm39) Q626R probably damaging Het
Adcy10 A T 1: 165,378,867 (GRCm39) Q885H probably damaging Het
Alkal2 C T 12: 30,940,055 (GRCm39) L139F probably damaging Het
Ankrd17 A T 5: 90,441,062 (GRCm39) M439K probably benign Het
Arl11 C A 14: 61,548,422 (GRCm39) Y77* probably null Het
Bcas3 T C 11: 85,449,973 (GRCm39) Y669H probably benign Het
Bpifb3 C T 2: 153,764,516 (GRCm39) A136V probably benign Het
Ccne2 A G 4: 11,202,279 (GRCm39) T345A probably benign Het
Ciz1 T C 2: 32,254,286 (GRCm39) S76P probably benign Het
Clip4 A T 17: 72,107,800 (GRCm39) K94* probably null Het
Cthrc1 G A 15: 38,947,866 (GRCm39) R195H probably damaging Het
Ddx31 T C 2: 28,730,816 (GRCm39) probably benign Het
Elf2 T A 3: 51,174,188 (GRCm39) D113V possibly damaging Het
Esrrb A G 12: 86,535,324 (GRCm39) N155S probably benign Het
Flnb A G 14: 7,887,624 (GRCm38) D478G probably benign Het
Galm T A 17: 80,435,215 (GRCm39) L24H probably damaging Het
Gask1b T C 3: 79,816,078 (GRCm39) S363P possibly damaging Het
Gon4l G A 3: 88,802,314 (GRCm39) G975D possibly damaging Het
Hspbp1 T G 7: 4,667,783 (GRCm39) M237L probably benign Het
Ighv1-62-1 A T 12: 115,350,367 (GRCm39) M100K probably damaging Het
Ipo8 A T 6: 148,676,575 (GRCm39) D971E possibly damaging Het
Itgax C T 7: 127,732,979 (GRCm39) A286V probably damaging Het
Jpt2 T C 17: 25,179,578 (GRCm39) Q3R probably benign Het
Katnip A C 7: 125,396,867 (GRCm39) R309S probably benign Het
Klrg2 A C 6: 38,613,838 (GRCm39) L55R probably damaging Het
Lrp6 T A 6: 134,433,141 (GRCm39) M1397L probably benign Het
Lrrc31 T A 3: 30,733,328 (GRCm39) Q462L probably benign Het
Lyg2 T A 1: 37,949,054 (GRCm39) I103F probably damaging Het
Map10 T C 8: 126,396,664 (GRCm39) V19A probably damaging Het
Map1b T A 13: 99,569,323 (GRCm39) M1133L unknown Het
Mrgpra4 A G 7: 47,631,481 (GRCm39) V40A probably benign Het
Myh1 G A 11: 67,099,967 (GRCm39) G626R probably benign Het
Myo9a T C 9: 59,687,030 (GRCm39) V45A probably benign Het
Ncdn A G 4: 126,638,905 (GRCm39) F638S possibly damaging Het
Ncs1 T A 2: 31,174,213 (GRCm39) M121K probably damaging Het
Nf1 T C 11: 79,437,180 (GRCm39) V16A probably damaging Het
Nktr T A 9: 121,579,317 (GRCm39) D1128E unknown Het
Nup205 T G 6: 35,191,269 (GRCm39) L1000R probably damaging Het
Obscn T C 11: 58,925,921 (GRCm39) E5604G probably damaging Het
Or1p4-ps1 T A 11: 74,208,534 (GRCm39) S228T unknown Het
Or2p2 T C 13: 21,257,220 (GRCm39) N84D probably damaging Het
Or4a68 A G 2: 89,270,209 (GRCm39) V138A probably benign Het
Or4c35 G T 2: 89,808,715 (GRCm39) A198S possibly damaging Het
Or5b96 A T 19: 12,867,560 (GRCm39) V127E probably damaging Het
Or7g12 A G 9: 18,899,812 (GRCm39) H176R possibly damaging Het
Ovch2 T A 7: 107,392,462 (GRCm39) I294F probably damaging Het
Ovch2 A T 7: 107,393,251 (GRCm39) C207* probably null Het
P3h2 T A 16: 25,801,467 (GRCm39) Y397F possibly damaging Het
Pappa A T 4: 65,123,166 (GRCm39) I834F possibly damaging Het
Pcdha11 T C 18: 37,140,716 (GRCm39) S782P probably benign Het
Pex1 T C 5: 3,681,614 (GRCm39) V980A probably benign Het
Pik3c2a G T 7: 115,951,112 (GRCm39) L1258I probably damaging Het
Pmp22 T A 11: 63,049,239 (GRCm39) *161R probably null Het
Ppp1r26 T A 2: 28,341,192 (GRCm39) M274K probably benign Het
Ppp6r2 T C 15: 89,167,275 (GRCm39) V830A probably benign Het
Pramel34 T C 5: 93,785,660 (GRCm39) T207A possibly damaging Het
Prss1 T A 6: 41,439,520 (GRCm39) N84K probably benign Het
Rab3il1 G A 19: 10,004,141 (GRCm39) A18T probably damaging Het
Sbf2 A T 7: 109,929,069 (GRCm39) S1471T probably damaging Het
Setdb1 T A 3: 95,263,371 (GRCm39) D45V probably damaging Het
Sik3 G T 9: 46,089,811 (GRCm39) V275L probably benign Het
Skint6 C A 4: 112,846,149 (GRCm39) M659I probably benign Het
Slc24a1 T A 9: 64,835,985 (GRCm39) D714V unknown Het
Slc26a5 T A 5: 22,018,880 (GRCm39) D653V probably damaging Het
Snrnp27 A T 6: 86,653,196 (GRCm39) C141S probably benign Het
Stradb A G 1: 59,033,478 (GRCm39) I380M probably benign Het
Sult1e1 T C 5: 87,735,501 (GRCm39) Y59C probably benign Het
Tas2r122 C T 6: 132,688,702 (GRCm39) A64T probably benign Het
Tep1 C T 14: 51,074,589 (GRCm39) C1812Y probably damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trio A T 15: 27,905,311 (GRCm39) C152S unknown Het
Tro G A X: 149,438,555 (GRCm39) S34L unknown Het
Vmn1r15 A G 6: 57,235,123 (GRCm39) probably benign Het
Vmn1r19 A G 6: 57,381,436 (GRCm39) probably benign Het
Vmn1r75 A G 7: 11,614,630 (GRCm39) T121A possibly damaging Het
Vmn2r32 A G 7: 7,477,669 (GRCm39) F241L probably damaging Het
Vmn2r66 A G 7: 84,654,893 (GRCm39) L472P probably damaging Het
Ylpm1 G T 12: 85,043,566 (GRCm39) W101C unknown Het
Zdbf2 C A 1: 63,347,272 (GRCm39) H1884N probably benign Het
Zfp1005 T A 2: 150,109,624 (GRCm39) C105S possibly damaging Het
Other mutations in Or51ah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Or51ah3 APN 7 103,210,563 (GRCm39) missense probably damaging 1.00
IGL01310:Or51ah3 APN 7 103,210,008 (GRCm39) missense probably benign
IGL01597:Or51ah3 APN 7 103,210,349 (GRCm39) missense possibly damaging 0.79
IGL01725:Or51ah3 APN 7 103,210,282 (GRCm39) nonsense probably null
IGL03291:Or51ah3 APN 7 103,210,119 (GRCm39) missense possibly damaging 0.93
R0055:Or51ah3 UTSW 7 103,210,244 (GRCm39) missense probably damaging 1.00
R0055:Or51ah3 UTSW 7 103,210,244 (GRCm39) missense probably damaging 1.00
R0189:Or51ah3 UTSW 7 103,210,289 (GRCm39) missense probably benign 0.01
R0254:Or51ah3 UTSW 7 103,209,829 (GRCm39) nonsense probably null
R1395:Or51ah3 UTSW 7 103,210,326 (GRCm39) missense possibly damaging 0.92
R1781:Or51ah3 UTSW 7 103,209,773 (GRCm39) missense probably benign 0.34
R2866:Or51ah3 UTSW 7 103,210,064 (GRCm39) missense probably damaging 1.00
R2958:Or51ah3 UTSW 7 103,210,512 (GRCm39) missense possibly damaging 0.54
R3922:Or51ah3 UTSW 7 103,209,912 (GRCm39) missense probably benign 0.00
R4306:Or51ah3 UTSW 7 103,210,380 (GRCm39) missense possibly damaging 0.50
R4306:Or51ah3 UTSW 7 103,210,379 (GRCm39) nonsense probably null
R4818:Or51ah3 UTSW 7 103,209,968 (GRCm39) missense probably benign 0.07
R4907:Or51ah3 UTSW 7 103,210,241 (GRCm39) missense possibly damaging 0.85
R4993:Or51ah3 UTSW 7 103,210,524 (GRCm39) missense possibly damaging 0.63
R5461:Or51ah3 UTSW 7 103,209,780 (GRCm39) missense probably damaging 1.00
R6225:Or51ah3 UTSW 7 103,210,489 (GRCm39) missense probably benign 0.01
R6621:Or51ah3 UTSW 7 103,210,085 (GRCm39) missense possibly damaging 0.93
R7174:Or51ah3 UTSW 7 103,210,598 (GRCm39) nonsense probably null
R7665:Or51ah3 UTSW 7 103,210,523 (GRCm39) missense probably benign 0.00
R7684:Or51ah3 UTSW 7 103,210,425 (GRCm39) missense probably benign 0.01
R8934:Or51ah3 UTSW 7 103,210,290 (GRCm39) missense probably benign 0.01
R9199:Or51ah3 UTSW 7 103,210,143 (GRCm39) missense probably damaging 1.00
R9243:Or51ah3 UTSW 7 103,209,782 (GRCm39) missense probably benign
R9276:Or51ah3 UTSW 7 103,210,004 (GRCm39) missense probably damaging 1.00
Z1088:Or51ah3 UTSW 7 103,210,597 (GRCm39) missense probably damaging 0.97
Z1088:Or51ah3 UTSW 7 103,210,266 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTTCCAGGGTTCAGTGACAG -3'
(R):5'- TCCTGAACCCATGGAAGAAGATG -3'

Sequencing Primer
(F):5'- GAGAAACTGCTTTGCACAGTGATTC -3'
(R):5'- CTGAACCCATGGAAGAAGATGTATGG -3'
Posted On 2021-04-30