Incidental Mutation 'R8812:Ylpm1'
ID 672513
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene Name YLP motif containing 1
Synonyms ZAP, A930013E17Rik, Zap3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 84996321-85070515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 84996792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Cysteine at position 101 (W101C)
Ref Sequence ENSEMBL: ENSMUSP00000021670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000168977]
AlphaFold Q9R0I7
Predicted Effect unknown
Transcript: ENSMUST00000021670
AA Change: W101C
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: W101C

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101202
AA Change: W101C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244
AA Change: W101C

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168977
AA Change: W101C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244
AA Change: W101C

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
R7514:Ylpm1 UTSW 12 85030494 missense possibly damaging 0.94
R7577:Ylpm1 UTSW 12 84997220 missense unknown
R7709:Ylpm1 UTSW 12 85013025 missense unknown
R7718:Ylpm1 UTSW 12 85029122 missense probably damaging 0.99
R7736:Ylpm1 UTSW 12 85012983 missense unknown
R7758:Ylpm1 UTSW 12 85015022 missense unknown
R7807:Ylpm1 UTSW 12 85014081 nonsense probably null
R7838:Ylpm1 UTSW 12 85048866 missense possibly damaging 0.90
R7846:Ylpm1 UTSW 12 85057268 missense probably damaging 0.98
R8170:Ylpm1 UTSW 12 85034027 missense probably benign 0.40
R8776:Ylpm1 UTSW 12 85030421 missense probably damaging 1.00
R8776-TAIL:Ylpm1 UTSW 12 85030421 missense probably damaging 1.00
R8847:Ylpm1 UTSW 12 85014898 missense unknown
R8874:Ylpm1 UTSW 12 85069620 missense probably damaging 1.00
R9129:Ylpm1 UTSW 12 85057278 missense
R9165:Ylpm1 UTSW 12 85030568 missense probably damaging 1.00
R9198:Ylpm1 UTSW 12 85033915 critical splice acceptor site probably null
R9564:Ylpm1 UTSW 12 85044402 missense probably benign 0.30
R9629:Ylpm1 UTSW 12 84997262 missense unknown
R9797:Ylpm1 UTSW 12 85030335 missense possibly damaging 0.86
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Z1176:Ylpm1 UTSW 12 85030284 missense possibly damaging 0.93
Z1177:Ylpm1 UTSW 12 85057283 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATATGTATCCGAATTGGGGCCG -3'
(R):5'- ATGTAGGATCCTGGAGGTACAG -3'

Sequencing Primer
(F):5'- GTACTCCAGTTCGACGGCTC -3'
(R):5'- CTGGAGGTACAGGGGGAGATTC -3'
Posted On 2021-04-30