Incidental Mutation 'R8812:Map1b'
ID 672518
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8812 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 99421446-99516540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 99432815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1133 (M1133L)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: M1133L
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: M1133L

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
R8470:Map1b UTSW 13 99516442 missense probably damaging 0.98
R8535:Map1b UTSW 13 99435154 missense probably damaging 1.00
R8777:Map1b UTSW 13 99430796 missense unknown
R8777-TAIL:Map1b UTSW 13 99430796 missense unknown
R8903:Map1b UTSW 13 99432509 nonsense probably null
R8928:Map1b UTSW 13 99432116 missense unknown
R8954:Map1b UTSW 13 99434227 missense unknown
R9164:Map1b UTSW 13 99425843 missense unknown
R9164:Map1b UTSW 13 99432308 nonsense probably null
R9190:Map1b UTSW 13 99435406 missense probably damaging 0.99
R9334:Map1b UTSW 13 99431640 missense unknown
R9339:Map1b UTSW 13 99431062 missense unknown
R9357:Map1b UTSW 13 99430200 nonsense probably null
R9430:Map1b UTSW 13 99434108 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCTTCCATGGACGAAGGTGG -3'
(R):5'- CGAGAACCTGCATCTTCAATTCATG -3'

Sequencing Primer
(F):5'- CGGAAGCGTTGTAATCCTTAC -3'
(R):5'- TTCATGATGAGACCCTACCTGGAG -3'
Posted On 2021-04-30