Incidental Mutation 'R8812:Pcdha11'
ID672529
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Nameprotocadherin alpha 11
SynonymsA830022B16Rik, Crnr7, Cnr7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8812 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37010712-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37007663 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 782 (S782P)
Ref Sequence ENSEMBL: ENSMUSP00000111322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115657
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115658
AA Change: S782P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440
AA Change: S782P

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192447
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37185008 missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37012833 missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37007704 intron probably benign
R2422:Pcdha11 UTSW 18 37007272 missense probably damaging 0.99
R2423:Pcdha11 UTSW 18 37007424 missense possibly damaging 0.89
R2508:Pcdha11 UTSW 18 37012854 missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37011807 missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37012790 missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37006743 missense possibly damaging 0.70
R4454:Pcdha11 UTSW 18 37007373 missense probably benign 0.13
R4489:Pcdha11 UTSW 18 37006916 missense possibly damaging 0.78
R4626:Pcdha11 UTSW 18 37006998 missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37006944 missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37011452 missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37011027 missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37011596 missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37005882 missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37011026 missense probably benign
R5523:Pcdha11 UTSW 18 37012386 missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37006765 missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37011449 missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37011284 missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37007283 missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37011456 missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37005817 missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37005897 missense probably benign 0.26
R6416:Pcdha11 UTSW 18 37012169 splice site probably null
R6450:Pcdha11 UTSW 18 37013162 missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37011182 missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37005791 missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37011189 missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37005417 missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37007238 missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37011225 missense probably damaging 1.00
R7244:Pcdha11 UTSW 18 37011368 nonsense probably null
R7295:Pcdha11 UTSW 18 37006926 missense probably damaging 1.00
R7319:Pcdha11 UTSW 18 37013192 missense probably benign 0.10
R7352:Pcdha11 UTSW 18 37006845 missense probably damaging 1.00
R7516:Pcdha11 UTSW 18 37011618 missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37006266 nonsense probably null
R7660:Pcdha11 UTSW 18 37005851 missense probably benign 0.17
R7677:Pcdha11 UTSW 18 37011552 missense probably damaging 1.00
R7707:Pcdha11 UTSW 18 37011792 missense probably benign 0.00
R7775:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7778:Pcdha11 UTSW 18 37012680 missense possibly damaging 0.64
R7780:Pcdha11 UTSW 18 37012796 missense probably damaging 0.97
R7916:Pcdha11 UTSW 18 37007388 missense probably benign 0.01
R7991:Pcdha11 UTSW 18 37012856 missense probably damaging 0.99
R8068:Pcdha11 UTSW 18 37005565 missense probably damaging 1.00
R8220:Pcdha11 UTSW 18 37006571 missense probably benign 0.01
R8252:Pcdha11 UTSW 18 37007537 missense possibly damaging 0.65
R8392:Pcdha11 UTSW 18 37006159 nonsense probably null
R8398:Pcdha11 UTSW 18 37013063 missense possibly damaging 0.65
R8470:Pcdha11 UTSW 18 37012884 missense probably benign 0.07
R8900:Pcdha11 UTSW 18 37012746 missense probably damaging 1.00
R8968:Pcdha11 UTSW 18 37012254 missense probably damaging 1.00
RF017:Pcdha11 UTSW 18 37005524 missense possibly damaging 0.92
Z1177:Pcdha11 UTSW 18 37012923 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGATCATCGCCATCTGTGCG -3'
(R):5'- GGCAAGTAGTCTTTAAATGAGCTGTC -3'

Sequencing Primer
(F):5'- GTGCTCACACTGGTGTTGTACAC -3'
(R):5'- TGAGCTGTCTCAAGAAAAGCAAC -3'
Posted On2021-04-30