Incidental Mutation 'R8812:Tro'
ID 672532
Institutional Source Beutler Lab
Gene Symbol Tro
Ensembl Gene ENSMUSG00000025272
Gene Name trophinin
Synonyms Maged3, Maged3l, magphinin, magphinin-alpha, magphinin-beta 2, magphinin-gamma, necdin and trophinin like, Tnn, Trol, trophinin-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R8812 (G1)
Quality Score 221.999
Status Not validated
Chromosome X
Chromosomal Location 150645304-150657583 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 150655559 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 34 (S34L)
Ref Sequence ENSEMBL: ENSMUSP00000084513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087253] [ENSMUST00000087258] [ENSMUST00000112709] [ENSMUST00000148604] [ENSMUST00000151403] [ENSMUST00000163450] [ENSMUST00000163969] [ENSMUST00000164071]
AlphaFold Q6DIC6
Predicted Effect unknown
Transcript: ENSMUST00000087253
AA Change: S34L
SMART Domains Protein: ENSMUSP00000084508
Gene: ENSMUSG00000025272
AA Change: S34L

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_2 62 105 5.33e-6 PROSPERO
internal_repeat_1 95 280 8.68e-15 PROSPERO
internal_repeat_2 120 164 5.33e-6 PROSPERO
internal_repeat_1 275 441 8.68e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 8e-60 PFAM
SCOP:d1gt91_ 780 951 9e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087258
AA Change: S34L
SMART Domains Protein: ENSMUSP00000084513
Gene: ENSMUSG00000025272
AA Change: S34L

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 1.6e-58 PFAM
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112709
AA Change: S34L
SMART Domains Protein: ENSMUSP00000108329
Gene: ENSMUSG00000025272
AA Change: S34L

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_3 62 105 6.04e-6 PROSPERO
internal_repeat_2 95 280 2.73e-15 PROSPERO
internal_repeat_3 120 164 6.04e-6 PROSPERO
internal_repeat_2 275 441 2.73e-15 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
MAGE 596 765 2.03e-90 SMART
low complexity region 794 810 N/A INTRINSIC
low complexity region 891 1028 N/A INTRINSIC
low complexity region 1057 1073 N/A INTRINSIC
low complexity region 1087 1108 N/A INTRINSIC
low complexity region 1110 1142 N/A INTRINSIC
low complexity region 1144 1155 N/A INTRINSIC
low complexity region 1157 1175 N/A INTRINSIC
internal_repeat_1 1176 1361 9.97e-23 PROSPERO
low complexity region 1393 1409 N/A INTRINSIC
internal_repeat_1 1540 1728 9.97e-23 PROSPERO
low complexity region 1764 1786 N/A INTRINSIC
low complexity region 1790 1815 N/A INTRINSIC
low complexity region 1821 1836 N/A INTRINSIC
low complexity region 1870 1910 N/A INTRINSIC
low complexity region 1915 1931 N/A INTRINSIC
low complexity region 1962 2085 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148604
AA Change: S34L
SMART Domains Protein: ENSMUSP00000116905
Gene: ENSMUSG00000025272
AA Change: S34L

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.1e-9 PROSPERO
internal_repeat_1 275 441 5.1e-9 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151403
AA Change: S34L
SMART Domains Protein: ENSMUSP00000120457
Gene: ENSMUSG00000025272
AA Change: S34L

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 6.85e-11 PROSPERO
internal_repeat_1 275 441 6.85e-11 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 6.3e-60 PFAM
low complexity region 794 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163450
Predicted Effect unknown
Transcript: ENSMUST00000163969
AA Change: S34L
SMART Domains Protein: ENSMUSP00000126054
Gene: ENSMUSG00000025272
AA Change: S34L

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
internal_repeat_1 95 280 5.6e-10 PROSPERO
internal_repeat_1 275 441 5.6e-10 PROSPERO
low complexity region 445 471 N/A INTRINSIC
low complexity region 491 501 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
Pfam:MAGE 596 765 5.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164071
SMART Domains Protein: ENSMUSP00000126042
Gene: ENSMUSG00000025272

DomainStartEndE-ValueType
Pfam:MAGE 54 223 7.1e-61 PFAM
low complexity region 252 266 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that mediates cell adhesion between trophoblastic cells and the epithelial cells of the endometrium. The encoded protein participates in cell signalling during embryo implantation, and may also be involved in cancer formation. This gene is located near several other closely related genes on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
PHENOTYPE: Homozygous female or hemizygous male mice on a mixed 129 and NIH black Swiss background are viable, fertile and elderly mice exhibit no disorders. On an inbred 129 background, homozygous female or hemizygous male mice show partial embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Tro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Tro APN X 150655325 missense probably benign 0.45
IGL00818:Tro APN X 150648361 missense probably damaging 1.00
IGL03170:Tro APN X 150655560 missense probably benign 0.36
R0022:Tro UTSW X 150647512 intron probably benign
R0049:Tro UTSW X 150654569 missense possibly damaging 0.56
R1378:Tro UTSW X 150655571 missense probably damaging 1.00
R2228:Tro UTSW X 150655481 missense probably benign 0.17
R3080:Tro UTSW X 150655202 missense probably benign 0.09
R3437:Tro UTSW X 150646256 intron probably benign
R3715:Tro UTSW X 150654234 missense probably damaging 1.00
R3783:Tro UTSW X 150655052 missense possibly damaging 0.83
R3787:Tro UTSW X 150655052 missense possibly damaging 0.83
R3840:Tro UTSW X 150646202 intron probably benign
R4001:Tro UTSW X 150655202 missense probably benign 0.09
R5449:Tro UTSW X 150645970 intron probably benign
R7112:Tro UTSW X 150645856 intron probably benign
R7909:Tro UTSW X 150648624 intron probably benign
R8811:Tro UTSW X 150655559 missense unknown
R8813:Tro UTSW X 150655559 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTGAAGCCTGACTGATCTG -3'
(R):5'- AGAGGAAACTTATCTATCTCTTGCTCC -3'

Sequencing Primer
(F):5'- CCTGACTGATCTGGGTGAAC -3'
(R):5'- AACTTATCTATCTCTTGCTCCATCCC -3'
Posted On 2021-04-30