Incidental Mutation 'R8813:Erich3'
ID 672544
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Name glutamate rich 3
Synonyms 4922501L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8813 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 154663859-154767790 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 154763190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1093 (D1093G)
Ref Sequence ENSEMBL: ENSMUSP00000096097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098496] [ENSMUST00000189969]
AlphaFold F6QRE9
Predicted Effect unknown
Transcript: ENSMUST00000098496
AA Change: D1093G
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: D1093G

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189969
SMART Domains Protein: ENSMUSP00000140929
Gene: ENSMUSG00000078161

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 T C 2: 122,640,702 L62P probably damaging Het
Amotl2 T G 9: 102,730,092 S700A probably damaging Het
Ccdc7a A G 8: 128,823,461 S1259P possibly damaging Het
Cenpj C T 14: 56,552,898 E565K probably damaging Het
Clmp C T 9: 40,781,253 R273* probably null Het
Cops7b A T 1: 86,601,124 Q191L probably benign Het
Cyp2c23 A G 19: 44,013,615 F312L probably benign Het
Dgkd G A 1: 87,915,544 C169Y probably damaging Het
Dlec1 A T 9: 119,127,430 N724I probably benign Het
Dmxl1 T C 18: 49,957,339 V2831A probably damaging Het
Dnah5 G T 15: 28,229,573 G118W probably damaging Het
Dnah6 G T 6: 73,127,954 T1884K probably damaging Het
Efnb2 T A 8: 8,620,731 S290C probably damaging Het
Eif2ak4 C A 2: 118,448,325 T990K probably damaging Het
Gm13088 T A 4: 143,654,343 N370I probably damaging Het
Gm4027 A G 12: 87,621,823 D75G probably damaging Het
H2-DMa T C 17: 34,135,760 probably benign Het
Habp2 G A 19: 56,306,784 D36N probably benign Het
Kcnk13 G T 12: 100,061,388 G241W probably damaging Het
Kdm6b GGGTGGTGGTGGTGGTGG GGGTGGTGGTGGTGGTGGTGG 11: 69,406,829 probably benign Het
Kdm6b TGG TGGGGG 11: 69,406,832 probably benign Het
Klk5 G T 7: 43,847,125 M160I probably benign Het
Lonp2 A G 8: 86,631,445 Y98C probably damaging Het
Marcksl1 C T 4: 129,515,206 P193S probably benign Het
Nup133 AAGAGA AAGA 8: 123,911,888 900 probably null Het
Nxf7 G A X: 135,583,766 R513C possibly damaging Het
Olfr1246 A T 2: 89,590,386 M243K probably benign Het
Olfr525 C A 7: 140,322,880 Y60* probably null Het
Olfr678 T A 7: 105,070,311 Y281* probably null Het
Olfr850 T G 9: 19,478,181 D23A possibly damaging Het
Olfr854 A T 9: 19,566,599 Y262N probably damaging Het
Otof T A 5: 30,382,898 M965L probably benign Het
Parp12 A G 6: 39,096,574 F439S probably damaging Het
Pde1a G A 2: 80,128,917 probably benign Het
Prrc2c T C 1: 162,705,243 N1268D unknown Het
Pter T C 2: 12,980,303 V148A probably benign Het
Rb1 A G 14: 73,262,587 M540T probably damaging Het
Rnasel T A 1: 153,753,895 N52K probably damaging Het
Rragd A T 4: 33,012,953 I317F possibly damaging Het
Sla G T 15: 66,792,278 S81R probably benign Het
T A G 17: 8,434,700 E57G probably benign Het
Tanc1 T A 2: 59,799,921 F748L probably damaging Het
Tnxb T A 17: 34,719,162 W3073R probably damaging Het
Trim33 A G 3: 103,346,736 T967A probably benign Het
Tro G A X: 150,655,559 S34L unknown Het
Trpm1 T A 7: 64,202,008 M158K possibly damaging Het
Vmn1r205 A G 13: 22,592,254 L226P probably benign Het
Vmn1r56 C T 7: 5,195,734 V295M probably damaging Het
Vps13c A G 9: 67,871,284 D208G probably damaging Het
Wdr78 T C 4: 103,090,500 E193G possibly damaging Het
Zfp11 T C 5: 129,658,214 D61G probably benign Het
Zscan4e C A 7: 11,307,613 E139* probably null Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
R7400:Erich3 UTSW 3 154762577 missense
R7421:Erich3 UTSW 3 154733561 missense probably damaging 1.00
R7520:Erich3 UTSW 3 154763126 missense unknown
R7553:Erich3 UTSW 3 154733500 missense probably benign 0.01
R7751:Erich3 UTSW 3 154763789 missense unknown
R7768:Erich3 UTSW 3 154748331 missense probably benign 0.00
R7955:Erich3 UTSW 3 154739314 nonsense probably null
R8001:Erich3 UTSW 3 154713916 missense probably benign 0.21
R8101:Erich3 UTSW 3 154733513 missense probably damaging 0.99
R8108:Erich3 UTSW 3 154720115 missense possibly damaging 0.91
R8162:Erich3 UTSW 3 154764573 missense unknown
R8310:Erich3 UTSW 3 154704949 missense
R8360:Erich3 UTSW 3 154764354 missense unknown
R8418:Erich3 UTSW 3 154709741 missense
R8490:Erich3 UTSW 3 154695824 missense
R8545:Erich3 UTSW 3 154762359 unclassified probably benign
R8944:Erich3 UTSW 3 154757055 missense
R8987:Erich3 UTSW 3 154709703 missense
R9036:Erich3 UTSW 3 154763249 missense unknown
R9135:Erich3 UTSW 3 154762275 missense
R9175:Erich3 UTSW 3 154713964 missense probably benign 0.02
R9284:Erich3 UTSW 3 154698671 missense
R9339:Erich3 UTSW 3 154763235 missense unknown
R9626:Erich3 UTSW 3 154739093 missense probably benign 0.10
Z1176:Erich3 UTSW 3 154698701 missense
Z1176:Erich3 UTSW 3 154762430 missense
Predicted Primers PCR Primer
(F):5'- TCCCACAGGAAAGGTAGCAG -3'
(R):5'- CAGAAAGTCCTTCCTCTCTGTGG -3'

Sequencing Primer
(F):5'- CACAGGAAAGGTAGCAGCAGAAG -3'
(R):5'- GAGGACTGTCTCTTCAGAACCAG -3'
Posted On 2021-04-30