Incidental Mutation 'T0970:Serinc3'
ID67255
Institutional Source Beutler Lab
Gene Symbol Serinc3
Ensembl Gene ENSMUSG00000017707
Gene Nameserine incorporator 3
SynonymsAIGP1, DIFF33, TMS-1, Tde1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #T0970 (G3) of strain 713
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location163623272-163645131 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TATCATC to TATC at 163627915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000017851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017851]
Predicted Effect probably benign
Transcript: ENSMUST00000017851
SMART Domains Protein: ENSMUSP00000017851
Gene: ENSMUSG00000017707

DomainStartEndE-ValueType
Pfam:Serinc 16 470 9e-168 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L591* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably null Het
Glis3 G A 19: 28,530,932 R551W probably damaging Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Map3k14 G T 11: 103,224,298 C837* probably null Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nphp4 T C 4: 152,556,379 S1068P probably damaging Het
Nup98 A C 7: 102,186,752 probably benign Het
Olfr1340 A G 4: 118,726,267 R7G probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Prss38 A G 11: 59,373,148 V246A possibly damaging Het
Rnf26 C G 9: 44,112,072 R172P probably damaging Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Txnrd2 T C 16: 18,441,773 V185A probably damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Wtap T C 17: 12,969,390 probably benign Het
Other mutations in Serinc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Serinc3 APN 2 163628001 missense probably damaging 1.00
IGL01152:Serinc3 APN 2 163636911 missense probably damaging 0.99
IGL02879:Serinc3 APN 2 163632252 splice site probably benign
IGL02945:Serinc3 APN 2 163630916 splice site probably benign
R0783:Serinc3 UTSW 2 163637003 missense possibly damaging 0.95
R1181:Serinc3 UTSW 2 163625526 missense probably damaging 1.00
R1848:Serinc3 UTSW 2 163645489 unclassified probably benign
R4254:Serinc3 UTSW 2 163636968 missense probably benign
R6225:Serinc3 UTSW 2 163627879 missense probably damaging 1.00
R6271:Serinc3 UTSW 2 163630976 missense probably benign 0.15
R6860:Serinc3 UTSW 2 163634446 missense probably benign
R6986:Serinc3 UTSW 2 163627971 missense probably benign 0.00
R7060:Serinc3 UTSW 2 163636959 missense probably benign 0.01
R7618:Serinc3 UTSW 2 163630969 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGCATACAGAGCTGGACTGGCA -3'
(R):5'- GGTGTGTGGACAAGCCCTCTGAT -3'

Sequencing Primer
(F):5'- tgaggtagaggcaggcag -3'
(R):5'- TGGACAAGCCCTCTGATTTATG -3'
Posted On2013-09-03