Incidental Mutation 'R8813:Nup133'
ID672561
Institutional Source Beutler Lab
Gene Symbol Nup133
Ensembl Gene ENSMUSG00000039509
Gene Namenucleoporin 133
Synonymsmermaid, 4832420O05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8813 (G1)
Quality Score217.468
Status Not validated
Chromosome8
Chromosomal Location123897123-123949265 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAGAGA to AAGA at 123911888 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]
Predicted Effect probably null
Transcript: ENSMUST00000044795
SMART Domains Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
PDB:1XKS|A 66 513 N/A PDB
Pfam:Nucleoporin_C 593 1052 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 T C 2: 122,640,702 L62P probably damaging Het
Amotl2 T G 9: 102,730,092 S700A probably damaging Het
Ccdc7a A G 8: 128,823,461 S1259P possibly damaging Het
Cenpj C T 14: 56,552,898 E565K probably damaging Het
Clmp C T 9: 40,781,253 R273* probably null Het
Cops7b A T 1: 86,601,124 Q191L probably benign Het
Cyp2c23 A G 19: 44,013,615 F312L probably benign Het
Dgkd G A 1: 87,915,544 C169Y probably damaging Het
Dlec1 A T 9: 119,127,430 N724I probably benign Het
Dmxl1 T C 18: 49,957,339 V2831A probably damaging Het
Dnah5 G T 15: 28,229,573 G118W probably damaging Het
Dnah6 G T 6: 73,127,954 T1884K probably damaging Het
Efnb2 T A 8: 8,620,731 S290C probably damaging Het
Eif2ak4 C A 2: 118,448,325 T990K probably damaging Het
Erich3 A G 3: 154,763,190 D1093G unknown Het
Gm13088 T A 4: 143,654,343 N370I probably damaging Het
Gm4027 A G 12: 87,621,823 D75G probably damaging Het
H2-DMa T C 17: 34,135,760 probably benign Het
Habp2 G A 19: 56,306,784 D36N probably benign Het
Kcnk13 G T 12: 100,061,388 G241W probably damaging Het
Kdm6b GGGTGGTGGTGGTGGTGG GGGTGGTGGTGGTGGTGGTGG 11: 69,406,829 probably benign Het
Kdm6b TGG TGGGGG 11: 69,406,832 probably benign Het
Klk5 G T 7: 43,847,125 M160I probably benign Het
Lonp2 A G 8: 86,631,445 Y98C probably damaging Het
Marcksl1 C T 4: 129,515,206 P193S probably benign Het
Nxf7 G A X: 135,583,766 R513C possibly damaging Het
Olfr1246 A T 2: 89,590,386 M243K probably benign Het
Olfr525 C A 7: 140,322,880 Y60* probably null Het
Olfr678 T A 7: 105,070,311 Y281* probably null Het
Olfr850 T G 9: 19,478,181 D23A possibly damaging Het
Olfr854 A T 9: 19,566,599 Y262N probably damaging Het
Otof T A 5: 30,382,898 M965L probably benign Het
Parp12 A G 6: 39,096,574 F439S probably damaging Het
Pde1a G A 2: 80,128,917 probably benign Het
Prrc2c T C 1: 162,705,243 N1268D unknown Het
Pter T C 2: 12,980,303 V148A probably benign Het
Rb1 A G 14: 73,262,587 M540T probably damaging Het
Rnasel T A 1: 153,753,895 N52K probably damaging Het
Rragd A T 4: 33,012,953 I317F possibly damaging Het
Sla G T 15: 66,792,278 S81R probably benign Het
T A G 17: 8,434,700 E57G probably benign Het
Tanc1 T A 2: 59,799,921 F748L probably damaging Het
Tnxb T A 17: 34,719,162 W3073R probably damaging Het
Trim33 A G 3: 103,346,736 T967A probably benign Het
Tro G A X: 150,655,559 S34L unknown Het
Trpm1 T A 7: 64,202,008 M158K possibly damaging Het
Vmn1r205 A G 13: 22,592,254 L226P probably benign Het
Vmn1r56 C T 7: 5,195,734 V295M probably damaging Het
Vps13c A G 9: 67,871,284 D208G probably damaging Het
Wdr78 T C 4: 103,090,500 E193G possibly damaging Het
Zfp11 T C 5: 129,658,214 D61G probably benign Het
Zscan4e C A 7: 11,307,613 E139* probably null Het
Other mutations in Nup133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Nup133 APN 8 123939083 missense probably damaging 0.98
IGL00507:Nup133 APN 8 123918967 nonsense probably null
IGL00585:Nup133 APN 8 123909994 missense probably damaging 1.00
IGL00676:Nup133 APN 8 123906298 intron probably benign
IGL00966:Nup133 APN 8 123911906 missense probably damaging 0.98
IGL01069:Nup133 APN 8 123930982 nonsense probably null
IGL01553:Nup133 APN 8 123915324 missense possibly damaging 0.58
IGL01669:Nup133 APN 8 123939130 nonsense probably null
IGL01730:Nup133 APN 8 123938233 missense probably benign 0.00
IGL01996:Nup133 APN 8 123946595 missense probably benign 0.00
IGL02332:Nup133 APN 8 123907832 missense probably damaging 1.00
IGL02552:Nup133 APN 8 123929255 missense possibly damaging 0.75
IGL02956:Nup133 APN 8 123949083 missense probably benign 0.00
IGL03009:Nup133 APN 8 123933500 missense possibly damaging 0.46
IGL03036:Nup133 APN 8 123946594 missense probably benign 0.11
Slant UTSW 8 123916281 splice site probably null
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0010:Nup133 UTSW 8 123904579 missense probably damaging 1.00
R0139:Nup133 UTSW 8 123929343 missense probably benign 0.00
R0344:Nup133 UTSW 8 123917446 missense possibly damaging 0.82
R0730:Nup133 UTSW 8 123949008 missense probably benign 0.00
R1301:Nup133 UTSW 8 123917417 intron probably benign
R1453:Nup133 UTSW 8 123915375 missense probably benign 0.00
R1570:Nup133 UTSW 8 123949176 start codon destroyed possibly damaging 0.82
R1607:Nup133 UTSW 8 123949035 missense probably benign 0.02
R1773:Nup133 UTSW 8 123930983 nonsense probably null
R1992:Nup133 UTSW 8 123906221 missense possibly damaging 0.80
R2062:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2065:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2066:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R2068:Nup133 UTSW 8 123914575 missense probably damaging 1.00
R4397:Nup133 UTSW 8 123944301 missense probably benign 0.04
R4683:Nup133 UTSW 8 123930982 nonsense probably null
R4771:Nup133 UTSW 8 123929398 missense probably damaging 1.00
R4910:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4911:Nup133 UTSW 8 123927131 missense possibly damaging 0.91
R4968:Nup133 UTSW 8 123915196 missense probably benign 0.07
R5411:Nup133 UTSW 8 123927206 missense probably benign
R5470:Nup133 UTSW 8 123930966 missense probably benign 0.00
R5664:Nup133 UTSW 8 123906281 missense probably benign 0.01
R5907:Nup133 UTSW 8 123916299 missense possibly damaging 0.90
R6003:Nup133 UTSW 8 123938292 missense probably damaging 0.98
R6059:Nup133 UTSW 8 123914596 missense probably damaging 1.00
R6219:Nup133 UTSW 8 123936873 missense possibly damaging 0.90
R6292:Nup133 UTSW 8 123917437 missense probably benign 0.01
R6672:Nup133 UTSW 8 123916281 splice site probably null
R6737:Nup133 UTSW 8 123906291 missense probably damaging 0.99
R6763:Nup133 UTSW 8 123944278 missense possibly damaging 0.95
R6870:Nup133 UTSW 8 123899507 missense probably benign 0.08
R6975:Nup133 UTSW 8 123915318 missense probably damaging 0.99
R7101:Nup133 UTSW 8 123906227 missense possibly damaging 0.89
R7114:Nup133 UTSW 8 123915373 missense probably benign 0.00
R7271:Nup133 UTSW 8 123922414 missense probably benign 0.34
R7501:Nup133 UTSW 8 123922414 missense probably benign 0.34
R8054:Nup133 UTSW 8 123949217 intron probably benign
R8397:Nup133 UTSW 8 123922417 missense probably benign 0.17
R8703:Nup133 UTSW 8 123916282 critical splice donor site probably null
R8811:Nup133 UTSW 8 123911888 frame shift probably null
X0023:Nup133 UTSW 8 123909988 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGATTAATTAACCAGCTGCTTCTCG -3'
(R):5'- GAACTGCAAGGTGGCTTAGC -3'

Sequencing Primer
(F):5'- TCGTAAGCAAACCATCTTACCTTC -3'
(R):5'- GACCTGAGTCAGATTCTAGAGCCTC -3'
Posted On2021-04-30