Incidental Mutation 'T0970:Olfr1340'
ID67257
Institutional Source Beutler Lab
Gene Symbol Olfr1340
Ensembl Gene ENSMUSG00000070821
Gene Nameolfactory receptor 1340
SynonymsGA_x6K02T2QD9B-18823451-18822504, MOR258-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #T0970 (G3) of strain 713
Quality Score197
Status Validated
Chromosome4
Chromosomal Location118720138-118729395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118726267 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 7 (R7G)
Ref Sequence ENSEMBL: ENSMUSP00000149563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094834] [ENSMUST00000213436] [ENSMUST00000216242] [ENSMUST00000217334]
Predicted Effect probably benign
Transcript: ENSMUST00000094834
AA Change: R7G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092430
Gene: ENSMUSG00000070821
AA Change: R7G

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 4.4e-57 PFAM
Pfam:7tm_1 44 293 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213436
AA Change: R7G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216242
AA Change: R7G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217334
AA Change: R7G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L591* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably null Het
Glis3 G A 19: 28,530,932 R551W probably damaging Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Map3k14 G T 11: 103,224,298 C837* probably null Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nphp4 T C 4: 152,556,379 S1068P probably damaging Het
Nup98 A C 7: 102,186,752 probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Prss38 A G 11: 59,373,148 V246A possibly damaging Het
Rnf26 C G 9: 44,112,072 R172P probably damaging Het
Serinc3 TATCATC TATC 2: 163,627,915 probably benign Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Txnrd2 T C 16: 18,441,773 V185A probably damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Wtap T C 17: 12,969,390 probably benign Het
Other mutations in Olfr1340
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Olfr1340 UTSW 4 118726333 missense possibly damaging 0.86
R0335:Olfr1340 UTSW 4 118727170 missense probably null
R0517:Olfr1340 UTSW 4 118726634 missense probably damaging 1.00
R4463:Olfr1340 UTSW 4 118726658 missense probably benign 0.32
R6240:Olfr1340 UTSW 4 118726471 missense probably benign 0.00
R6481:Olfr1340 UTSW 4 118726733 missense probably damaging 1.00
R6930:Olfr1340 UTSW 4 118727141 missense probably damaging 1.00
R7662:Olfr1340 UTSW 4 118726307 missense probably damaging 0.99
R7681:Olfr1340 UTSW 4 118726564 missense probably benign 0.00
R7782:Olfr1340 UTSW 4 118726909 missense probably damaging 1.00
R7845:Olfr1340 UTSW 4 118726961 missense probably benign 0.00
R7928:Olfr1340 UTSW 4 118726961 missense probably benign 0.00
Z1176:Olfr1340 UTSW 4 118727141 missense probably damaging 1.00
Z1177:Olfr1340 UTSW 4 118727064 missense not run
Predicted Primers PCR Primer
(F):5'- GGAAACAACAGGCATTCCTTTCGAC -3'
(R):5'- GGTGTGTGGAGACGAGCATCTATTC -3'

Sequencing Primer
(F):5'- TCGACTTGTTTAAGAtgtgtgtg -3'
(R):5'- GACGAGCATCTATTCTAATCAGGG -3'
Posted On2013-09-03