Incidental Mutation 'R8813:H2-DMa'
ID 672579
Institutional Source Beutler Lab
Gene Symbol H2-DMa
Ensembl Gene ENSMUSG00000037649
Gene Name histocompatibility 2, class II, locus DMa
Synonyms H2-M alpha, H2-Ma, H-2Ma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock # R8813 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34135182-34139101 bp(+) (GRCm38)
Type of Mutation critical splice donor site
DNA Base Change (assembly) T to C at 34135760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042121]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042121
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired antigen presenting cell function, poor IgG responses to T-dependent antigens, reduced numbers of mature CD4+ T cells, and increased susceptibility to Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 T C 2: 122,640,702 L62P probably damaging Het
Amotl2 T G 9: 102,730,092 S700A probably damaging Het
Ccdc7a A G 8: 128,823,461 S1259P possibly damaging Het
Cenpj C T 14: 56,552,898 E565K probably damaging Het
Clmp C T 9: 40,781,253 R273* probably null Het
Cops7b A T 1: 86,601,124 Q191L probably benign Het
Cyp2c23 A G 19: 44,013,615 F312L probably benign Het
Dgkd G A 1: 87,915,544 C169Y probably damaging Het
Dlec1 A T 9: 119,127,430 N724I probably benign Het
Dmxl1 T C 18: 49,957,339 V2831A probably damaging Het
Dnah5 G T 15: 28,229,573 G118W probably damaging Het
Dnah6 G T 6: 73,127,954 T1884K probably damaging Het
Efnb2 T A 8: 8,620,731 S290C probably damaging Het
Eif2ak4 C A 2: 118,448,325 T990K probably damaging Het
Erich3 A G 3: 154,763,190 D1093G unknown Het
Gm13088 T A 4: 143,654,343 N370I probably damaging Het
Gm4027 A G 12: 87,621,823 D75G probably damaging Het
Habp2 G A 19: 56,306,784 D36N probably benign Het
Kcnk13 G T 12: 100,061,388 G241W probably damaging Het
Kdm6b GGGTGGTGGTGGTGGTGG GGGTGGTGGTGGTGGTGGTGG 11: 69,406,829 probably benign Het
Kdm6b TGG TGGGGG 11: 69,406,832 probably benign Het
Klk5 G T 7: 43,847,125 M160I probably benign Het
Lonp2 A G 8: 86,631,445 Y98C probably damaging Het
Marcksl1 C T 4: 129,515,206 P193S probably benign Het
Nup133 AAGAGA AAGA 8: 123,911,888 900 probably null Het
Nxf7 G A X: 135,583,766 R513C possibly damaging Het
Olfr1246 A T 2: 89,590,386 M243K probably benign Het
Olfr525 C A 7: 140,322,880 Y60* probably null Het
Olfr678 T A 7: 105,070,311 Y281* probably null Het
Olfr850 T G 9: 19,478,181 D23A possibly damaging Het
Olfr854 A T 9: 19,566,599 Y262N probably damaging Het
Otof T A 5: 30,382,898 M965L probably benign Het
Parp12 A G 6: 39,096,574 F439S probably damaging Het
Pde1a G A 2: 80,128,917 probably benign Het
Prrc2c T C 1: 162,705,243 N1268D unknown Het
Pter T C 2: 12,980,303 V148A probably benign Het
Rb1 A G 14: 73,262,587 M540T probably damaging Het
Rnasel T A 1: 153,753,895 N52K probably damaging Het
Rragd A T 4: 33,012,953 I317F possibly damaging Het
Sla G T 15: 66,792,278 S81R probably benign Het
T A G 17: 8,434,700 E57G probably benign Het
Tanc1 T A 2: 59,799,921 F748L probably damaging Het
Tnxb T A 17: 34,719,162 W3073R probably damaging Het
Trim33 A G 3: 103,346,736 T967A probably benign Het
Tro G A X: 150,655,559 S34L unknown Het
Trpm1 T A 7: 64,202,008 M158K possibly damaging Het
Vmn1r205 A G 13: 22,592,254 L226P probably benign Het
Vmn1r56 C T 7: 5,195,734 V295M probably damaging Het
Vps13c A G 9: 67,871,284 D208G probably damaging Het
Wdr78 T C 4: 103,090,500 E193G possibly damaging Het
Zfp11 T C 5: 129,658,214 D61G probably benign Het
Zscan4e C A 7: 11,307,613 E139* probably null Het
Other mutations in H2-DMa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:H2-DMa APN 17 34137109 splice site probably null
R0422:H2-DMa UTSW 17 34137947 missense probably damaging 1.00
R0620:H2-DMa UTSW 17 34137960 missense probably damaging 0.96
R1240:H2-DMa UTSW 17 34138406 critical splice acceptor site probably null
R1483:H2-DMa UTSW 17 34135750 missense possibly damaging 0.61
R1656:H2-DMa UTSW 17 34138142 missense possibly damaging 0.92
R1657:H2-DMa UTSW 17 34137399 critical splice donor site probably null
R1696:H2-DMa UTSW 17 34138413 missense probably benign 0.44
R2884:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R2886:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R5024:H2-DMa UTSW 17 34138487 missense possibly damaging 0.77
R5236:H2-DMa UTSW 17 34137939 missense probably damaging 1.00
R5632:H2-DMa UTSW 17 34138001 missense probably benign 0.14
R6358:H2-DMa UTSW 17 34137984 missense probably damaging 1.00
R6423:H2-DMa UTSW 17 34137196 missense probably benign 0.05
R7033:H2-DMa UTSW 17 34136997 splice site probably null
R7387:H2-DMa UTSW 17 34138127 missense probably damaging 1.00
R8060:H2-DMa UTSW 17 34137285 missense probably benign 0.05
R8504:H2-DMa UTSW 17 34138442 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGCGACTGATGATGTTAAAC -3'
(R):5'- GGTTGCTTGCCATTCGTGAAC -3'

Sequencing Primer
(F):5'- GCGACTGATGATGTTAAACTATACGC -3'
(R):5'- TTGCCATTCGTGAACAGCAG -3'
Posted On 2021-04-30