Incidental Mutation 'T0970:Nphp4'
ID67258
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Namenephronophthisis 4 (juvenile) homolog (human)
Synonymsnmf192, 4930564O18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #T0970 (G3) of strain 713
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152476706-152563183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152556379 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1068 (S1068P)
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
Predicted Effect probably damaging
Transcript: ENSMUST00000056567
AA Change: S1068P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: S1068P

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081393
AA Change: S1068P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: S1068P

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (25/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A T 10: 88,981,190 L591* probably null Het
Aqp4 A G 18: 15,399,883 L51P probably damaging Het
Cemip A T 7: 83,983,146 C403S probably damaging Het
Cfap74 G T 4: 155,463,117 probably null Het
Glis3 G A 19: 28,530,932 R551W probably damaging Het
Gm11232 T A 4: 71,756,503 Y254F possibly damaging Het
Gm11492 A T 11: 87,567,732 T311S probably damaging Het
Map3k14 G T 11: 103,224,298 C837* probably null Het
Mrc2 A C 11: 105,347,627 E1200A probably benign Het
Nfix T C 8: 84,726,483 N314S possibly damaging Het
Nup98 A C 7: 102,186,752 probably benign Het
Olfr1340 A G 4: 118,726,267 R7G probably benign Het
Pcdhac2 T C 18: 37,145,335 V456A possibly damaging Het
Pcdhb1 G T 18: 37,265,973 G326C probably damaging Het
Prss38 A G 11: 59,373,148 V246A possibly damaging Het
Rnf26 C G 9: 44,112,072 R172P probably damaging Het
Serinc3 TATCATC TATC 2: 163,627,915 probably benign Het
Spire1 C A 18: 67,501,063 probably null Het
Tex2 T A 11: 106,546,946 I633F unknown Het
Tle2 A G 10: 81,580,285 D108G possibly damaging Het
Txnrd2 T C 16: 18,441,773 V185A probably damaging Het
Unc45b C A 11: 82,922,888 H374N probably benign Het
Wtap T C 17: 12,969,390 probably benign Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152537309 splice site probably benign
IGL00963:Nphp4 APN 4 152537861 missense probably benign 0.01
IGL01571:Nphp4 APN 4 152556382 missense probably benign 0.21
IGL01707:Nphp4 APN 4 152538983 missense probably benign 0.00
IGL01837:Nphp4 APN 4 152488881 missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152555469 splice site probably benign
IGL02558:Nphp4 APN 4 152555531 missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152556220 missense probably benign 0.00
IGL02712:Nphp4 APN 4 152556275 missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152524235 splice site probably null
R0280:Nphp4 UTSW 4 152551936 splice site probably benign
R0317:Nphp4 UTSW 4 152551931 critical splice donor site probably null
R0410:Nphp4 UTSW 4 152557046 missense probably benign
R0433:Nphp4 UTSW 4 152518172 missense probably benign 0.00
R0706:Nphp4 UTSW 4 152555617 missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152562109 missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152498220 missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152538055 missense probably benign 0.01
R1202:Nphp4 UTSW 4 152488729 splice site probably null
R1203:Nphp4 UTSW 4 152488832 missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152502926 missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152547018 missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152562090 missense probably benign 0.00
R1699:Nphp4 UTSW 4 152496664 missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152554654 missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152559364 missense probably benign 0.38
R2264:Nphp4 UTSW 4 152503008 splice site probably benign
R2280:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152518139 missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152538017 splice site probably benign
R4084:Nphp4 UTSW 4 152488791 missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152547018 missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R4701:Nphp4 UTSW 4 152496659 missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152556291 missense probably benign 0.44
R4783:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4784:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4974:Nphp4 UTSW 4 152537793 missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152544462 splice site probably null
R5117:Nphp4 UTSW 4 152524232 splice site probably null
R5128:Nphp4 UTSW 4 152502991 missense probably benign 0.01
R5665:Nphp4 UTSW 4 152506485 missense probably benign 0.25
R5890:Nphp4 UTSW 4 152547079 missense probably benign 0.44
R6171:Nphp4 UTSW 4 152544449 missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152503007 splice site probably null
R6772:Nphp4 UTSW 4 152544406 missense probably benign 0.07
R6806:Nphp4 UTSW 4 152538101 missense probably benign 0.02
R7006:Nphp4 UTSW 4 152488802 missense probably benign 0.12
R7124:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R7381:Nphp4 UTSW 4 152499003 missense possibly damaging 0.94
R7411:Nphp4 UTSW 4 152554717 missense probably benign 0.25
R7638:Nphp4 UTSW 4 152554534 missense probably benign 0.08
R7814:Nphp4 UTSW 4 152524272 missense possibly damaging 0.93
R7814:Nphp4 UTSW 4 152544403 missense probably damaging 1.00
R7841:Nphp4 UTSW 4 152496683 missense probably benign 0.01
X0058:Nphp4 UTSW 4 152559707 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGCGTTGGACAGTTCTAACAC -3'
(R):5'- ACATGACTGACCTATGCCTTCCCTG -3'

Sequencing Primer
(F):5'- ACAGTTCTAACACTGTCCCTG -3'
(R):5'- CACACAGCCCTGGTGAGAAG -3'
Posted On2013-09-03