Incidental Mutation 'R8813:Cyp2c23'
ID672582
Institutional Source Beutler Lab
Gene Symbol Cyp2c23
Ensembl Gene ENSMUSG00000025197
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 23
SynonymsCyp2c44
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8813 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44005022-44029208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44013615 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 312 (F312L)
Ref Sequence ENSEMBL: ENSMUSP00000026211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026211] [ENSMUST00000211830]
Predicted Effect probably benign
Transcript: ENSMUST00000026211
AA Change: F312L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026211
Gene: ENSMUSG00000025197
AA Change: F312L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 34 491 2.1e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211830
AA Change: F312L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele show reduced proliferative and tubulogenic responses in lung endothelial cells, decreased tumor angiogenesis and growth of induced tumors, and high potassium-induced hypertension with decreased urinary sodium excretion and increased plasma sodium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 T C 2: 122,640,702 L62P probably damaging Het
Amotl2 T G 9: 102,730,092 S700A probably damaging Het
Ccdc7a A G 8: 128,823,461 S1259P possibly damaging Het
Cenpj C T 14: 56,552,898 E565K probably damaging Het
Clmp C T 9: 40,781,253 R273* probably null Het
Cops7b A T 1: 86,601,124 Q191L probably benign Het
Dgkd G A 1: 87,915,544 C169Y probably damaging Het
Dlec1 A T 9: 119,127,430 N724I probably benign Het
Dmxl1 T C 18: 49,957,339 V2831A probably damaging Het
Dnah5 G T 15: 28,229,573 G118W probably damaging Het
Dnah6 G T 6: 73,127,954 T1884K probably damaging Het
Efnb2 T A 8: 8,620,731 S290C probably damaging Het
Eif2ak4 C A 2: 118,448,325 T990K probably damaging Het
Erich3 A G 3: 154,763,190 D1093G unknown Het
Gm13088 T A 4: 143,654,343 N370I probably damaging Het
Gm4027 A G 12: 87,621,823 D75G probably damaging Het
H2-DMa T C 17: 34,135,760 probably benign Het
Habp2 G A 19: 56,306,784 D36N probably benign Het
Kcnk13 G T 12: 100,061,388 G241W probably damaging Het
Kdm6b GGGTGGTGGTGGTGGTGG GGGTGGTGGTGGTGGTGGTGG 11: 69,406,829 probably benign Het
Kdm6b TGG TGGGGG 11: 69,406,832 probably benign Het
Klk5 G T 7: 43,847,125 M160I probably benign Het
Lonp2 A G 8: 86,631,445 Y98C probably damaging Het
Marcksl1 C T 4: 129,515,206 P193S probably benign Het
Nup133 AAGAGA AAGA 8: 123,911,888 probably null Het
Nxf7 G A X: 135,583,766 R513C possibly damaging Het
Olfr1246 A T 2: 89,590,386 M243K probably benign Het
Olfr525 C A 7: 140,322,880 Y60* probably null Het
Olfr678 T A 7: 105,070,311 Y281* probably null Het
Olfr850 T G 9: 19,478,181 D23A possibly damaging Het
Olfr854 A T 9: 19,566,599 Y262N probably damaging Het
Otof T A 5: 30,382,898 M965L probably benign Het
Parp12 A G 6: 39,096,574 F439S probably damaging Het
Pde1a G A 2: 80,128,917 probably benign Het
Prrc2c T C 1: 162,705,243 N1268D unknown Het
Pter T C 2: 12,980,303 V148A probably benign Het
Rb1 A G 14: 73,262,587 M540T probably damaging Het
Rnasel T A 1: 153,753,895 N52K probably damaging Het
Rragd A T 4: 33,012,953 I317F possibly damaging Het
Sla G T 15: 66,792,278 S81R probably benign Het
T A G 17: 8,434,700 E57G probably benign Het
Tanc1 T A 2: 59,799,921 F748L probably damaging Het
Tnxb T A 17: 34,719,162 W3073R probably damaging Het
Trim33 A G 3: 103,346,736 T967A probably benign Het
Tro G A X: 150,655,559 S34L unknown Het
Trpm1 T A 7: 64,202,008 M158K possibly damaging Het
Vmn1r205 A G 13: 22,592,254 L226P probably benign Het
Vmn1r56 C T 7: 5,195,734 V295M probably damaging Het
Vps13c A G 9: 67,871,284 D208G probably damaging Het
Wdr78 T C 4: 103,090,500 E193G possibly damaging Het
Zfp11 T C 5: 129,658,214 D61G probably benign Het
Zscan4e C A 7: 11,307,613 E139* probably null Het
Other mutations in Cyp2c23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Cyp2c23 APN 19 44015073 missense possibly damaging 0.94
IGL01642:Cyp2c23 APN 19 44005556 missense probably damaging 1.00
IGL01782:Cyp2c23 APN 19 44029115 missense possibly damaging 0.77
IGL01843:Cyp2c23 APN 19 44005607 missense probably benign 0.02
IGL02902:Cyp2c23 APN 19 44021558 splice site probably benign
IGL03382:Cyp2c23 APN 19 44014932 missense probably damaging 0.99
R0196:Cyp2c23 UTSW 19 44012356 missense probably damaging 0.98
R0735:Cyp2c23 UTSW 19 44016810 missense probably damaging 1.00
R1384:Cyp2c23 UTSW 19 44013663 missense probably damaging 1.00
R1495:Cyp2c23 UTSW 19 44005508 missense probably benign 0.07
R1809:Cyp2c23 UTSW 19 44021558 splice site probably benign
R1872:Cyp2c23 UTSW 19 44005551 nonsense probably null
R2866:Cyp2c23 UTSW 19 44005446 missense probably damaging 1.00
R3801:Cyp2c23 UTSW 19 44007039 missense probably benign 0.11
R4234:Cyp2c23 UTSW 19 44029165 missense unknown
R4748:Cyp2c23 UTSW 19 44016737 splice site probably null
R4948:Cyp2c23 UTSW 19 44021699 missense possibly damaging 0.49
R5101:Cyp2c23 UTSW 19 44029183 missense unknown
R5420:Cyp2c23 UTSW 19 44015664 critical splice donor site probably null
R5770:Cyp2c23 UTSW 19 44021579 missense probably damaging 0.99
R5993:Cyp2c23 UTSW 19 44012360 missense probably damaging 1.00
R6254:Cyp2c23 UTSW 19 44005463 missense probably benign 0.03
R6269:Cyp2c23 UTSW 19 44029187 start codon destroyed unknown
R6610:Cyp2c23 UTSW 19 44007081 missense probably damaging 1.00
R7344:Cyp2c23 UTSW 19 44021737 splice site probably null
R7603:Cyp2c23 UTSW 19 44014930 missense probably damaging 1.00
R8054:Cyp2c23 UTSW 19 44007116 missense probably damaging 0.99
R8098:Cyp2c23 UTSW 19 44015803 missense probably benign 0.29
R8157:Cyp2c23 UTSW 19 44021627 missense probably benign 0.00
X0065:Cyp2c23 UTSW 19 44029171 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAGGTTTGAGATCCATACGTTC -3'
(R):5'- CAGGACACTAAAGGGACCTTGG -3'

Sequencing Primer
(F):5'- TTGAGATCCATACGTTCTACTTTTG -3'
(R):5'- GGACCTTGGAAAGAGTGGATC -3'
Posted On2021-04-30