Incidental Mutation 'R8814:Pask'
ID 672586
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene Name PAS domain containing serine/threonine kinase
Synonyms Paskin
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 93237159-93271244 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 93248307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 998 (R998L)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027493]
AlphaFold Q8CEE6
Predicted Effect probably benign
Transcript: ENSMUST00000027493
AA Change: R998L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: R998L

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93,238,574 (GRCm39) missense probably benign 0.02
IGL01620:Pask APN 1 93,237,844 (GRCm39) missense possibly damaging 0.87
IGL01959:Pask APN 1 93,262,329 (GRCm39) missense probably benign 0.03
IGL02170:Pask APN 1 93,238,606 (GRCm39) missense possibly damaging 0.69
IGL02499:Pask APN 1 93,248,817 (GRCm39) nonsense probably null
IGL02670:Pask APN 1 93,238,540 (GRCm39) missense probably damaging 1.00
IGL03066:Pask APN 1 93,258,588 (GRCm39) missense probably benign 0.02
IGL03210:Pask APN 1 93,247,714 (GRCm39) missense possibly damaging 0.92
R0472:Pask UTSW 1 93,248,639 (GRCm39) missense probably benign 0.00
R0524:Pask UTSW 1 93,238,556 (GRCm39) missense probably damaging 1.00
R0854:Pask UTSW 1 93,255,156 (GRCm39) missense possibly damaging 0.79
R0854:Pask UTSW 1 93,255,122 (GRCm39) missense probably damaging 0.99
R0854:Pask UTSW 1 93,255,134 (GRCm39) missense probably damaging 1.00
R0863:Pask UTSW 1 93,242,061 (GRCm39) missense probably damaging 1.00
R1052:Pask UTSW 1 93,258,549 (GRCm39) missense probably benign 0.00
R1406:Pask UTSW 1 93,249,373 (GRCm39) missense probably benign 0.00
R1406:Pask UTSW 1 93,249,373 (GRCm39) missense probably benign 0.00
R1831:Pask UTSW 1 93,248,491 (GRCm39) splice site probably null
R1958:Pask UTSW 1 93,249,180 (GRCm39) missense probably benign 0.00
R2143:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2144:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2145:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2509:Pask UTSW 1 93,258,485 (GRCm39) missense possibly damaging 0.62
R2858:Pask UTSW 1 93,249,373 (GRCm39) missense probably benign 0.00
R2899:Pask UTSW 1 93,262,269 (GRCm39) missense probably damaging 1.00
R3545:Pask UTSW 1 93,244,837 (GRCm39) missense probably damaging 1.00
R3778:Pask UTSW 1 93,255,189 (GRCm39) missense probably damaging 1.00
R4111:Pask UTSW 1 93,238,540 (GRCm39) missense probably damaging 1.00
R4514:Pask UTSW 1 93,249,855 (GRCm39) missense probably benign 0.03
R4527:Pask UTSW 1 93,248,224 (GRCm39) missense probably benign
R4580:Pask UTSW 1 93,249,830 (GRCm39) missense probably benign 0.36
R4718:Pask UTSW 1 93,249,918 (GRCm39) missense possibly damaging 0.67
R4775:Pask UTSW 1 93,265,246 (GRCm39) missense probably damaging 0.97
R5036:Pask UTSW 1 93,249,801 (GRCm39) nonsense probably null
R5070:Pask UTSW 1 93,258,596 (GRCm39) missense probably damaging 1.00
R5084:Pask UTSW 1 93,249,819 (GRCm39) missense probably benign
R5151:Pask UTSW 1 93,262,350 (GRCm39) missense probably damaging 1.00
R5196:Pask UTSW 1 93,237,805 (GRCm39) unclassified probably benign
R5643:Pask UTSW 1 93,265,065 (GRCm39) critical splice donor site probably null
R5739:Pask UTSW 1 93,249,778 (GRCm39) missense probably benign
R6126:Pask UTSW 1 93,242,081 (GRCm39) missense probably damaging 1.00
R7161:Pask UTSW 1 93,238,627 (GRCm39) missense probably benign
R7284:Pask UTSW 1 93,248,391 (GRCm39) missense probably benign 0.01
R7289:Pask UTSW 1 93,259,309 (GRCm39) missense probably damaging 1.00
R8277:Pask UTSW 1 93,253,085 (GRCm39) critical splice donor site probably null
R8303:Pask UTSW 1 93,248,286 (GRCm39) missense probably benign 0.10
R8309:Pask UTSW 1 93,240,573 (GRCm39) nonsense probably null
R8321:Pask UTSW 1 93,248,377 (GRCm39) missense possibly damaging 0.85
R8476:Pask UTSW 1 93,249,361 (GRCm39) missense probably benign 0.00
R9061:Pask UTSW 1 93,253,191 (GRCm39) nonsense probably null
R9198:Pask UTSW 1 93,265,205 (GRCm39) missense possibly damaging 0.72
R9406:Pask UTSW 1 93,251,987 (GRCm39) missense probably benign 0.02
R9578:Pask UTSW 1 93,263,390 (GRCm39) missense probably benign 0.00
Z1088:Pask UTSW 1 93,244,523 (GRCm39) missense probably damaging 1.00
Z1177:Pask UTSW 1 93,263,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCAGTGATGCTACCTG -3'
(R):5'- CTACTCTGGAAGCTGCTACC -3'

Sequencing Primer
(F):5'- GTGATGCTACCTGAAAAACCTG -3'
(R):5'- ACCGGGATGGCTTACAACTG -3'
Posted On 2021-04-30