Incidental Mutation 'R8814:Siglec1'
ID 672589
Institutional Source Beutler Lab
Gene Symbol Siglec1
Ensembl Gene ENSMUSG00000027322
Gene Name sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms Sn, CD169, Siglec-1
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130911140-130928685 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 130914664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1484 (T1484M)
Ref Sequence ENSEMBL: ENSMUSP00000028794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028794
AA Change: T1484M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: T1484M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 9.4e-18 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
IG_like 1549 1624 1.21e-1 SMART
transmembrane domain 1647 1669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110227
AA Change: T1484M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: T1484M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 7e-17 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r7 A G 3: 64,623,984 (GRCm39) I112T probably benign Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Siglec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Siglec1 APN 2 130,921,245 (GRCm39) missense probably benign 0.03
IGL01092:Siglec1 APN 2 130,921,137 (GRCm39) missense probably damaging 1.00
IGL01115:Siglec1 APN 2 130,916,422 (GRCm39) missense probably benign 0.01
IGL01324:Siglec1 APN 2 130,927,461 (GRCm39) missense probably damaging 1.00
IGL01330:Siglec1 APN 2 130,916,925 (GRCm39) nonsense probably null
IGL01330:Siglec1 APN 2 130,925,456 (GRCm39) missense probably damaging 1.00
IGL01558:Siglec1 APN 2 130,920,419 (GRCm39) missense probably damaging 0.96
IGL01632:Siglec1 APN 2 130,925,740 (GRCm39) missense probably benign 0.03
IGL01768:Siglec1 APN 2 130,916,314 (GRCm39) missense probably benign
IGL02399:Siglec1 APN 2 130,913,098 (GRCm39) missense probably benign 0.16
IGL02558:Siglec1 APN 2 130,916,915 (GRCm39) missense possibly damaging 0.88
IGL02794:Siglec1 APN 2 130,917,889 (GRCm39) missense possibly damaging 0.86
IGL02839:Siglec1 APN 2 130,926,852 (GRCm39) missense possibly damaging 0.82
aggressor UTSW 2 130,925,861 (GRCm39) nonsense probably null
boris UTSW 2 130,921,297 (GRCm39) nonsense probably null
espia UTSW 2 130,914,664 (GRCm39) missense probably damaging 0.98
hoodlum UTSW 2 130,914,667 (GRCm39) missense possibly damaging 0.88
microfische UTSW 2 130,928,015 (GRCm39) missense possibly damaging 0.73
K3955:Siglec1 UTSW 2 130,923,359 (GRCm39) missense probably benign 0.00
P0038:Siglec1 UTSW 2 130,923,359 (GRCm39) missense probably benign 0.00
PIT4576001:Siglec1 UTSW 2 130,920,081 (GRCm39) missense probably damaging 1.00
PIT4677001:Siglec1 UTSW 2 130,914,677 (GRCm39) missense probably damaging 1.00
R0003:Siglec1 UTSW 2 130,916,980 (GRCm39) missense probably benign 0.00
R0048:Siglec1 UTSW 2 130,915,317 (GRCm39) missense possibly damaging 0.65
R0048:Siglec1 UTSW 2 130,915,317 (GRCm39) missense possibly damaging 0.65
R0243:Siglec1 UTSW 2 130,927,396 (GRCm39) missense probably damaging 1.00
R0276:Siglec1 UTSW 2 130,925,861 (GRCm39) nonsense probably null
R0379:Siglec1 UTSW 2 130,916,445 (GRCm39) splice site probably benign
R0464:Siglec1 UTSW 2 130,921,279 (GRCm39) missense probably damaging 1.00
R0507:Siglec1 UTSW 2 130,916,445 (GRCm39) splice site probably benign
R0560:Siglec1 UTSW 2 130,912,266 (GRCm39) missense probably benign 0.02
R0620:Siglec1 UTSW 2 130,916,188 (GRCm39) missense probably benign 0.30
R0621:Siglec1 UTSW 2 130,916,188 (GRCm39) missense probably benign 0.30
R0853:Siglec1 UTSW 2 130,926,942 (GRCm39) missense probably damaging 0.98
R1079:Siglec1 UTSW 2 130,921,297 (GRCm39) nonsense probably null
R1169:Siglec1 UTSW 2 130,916,747 (GRCm39) missense probably damaging 0.97
R1205:Siglec1 UTSW 2 130,922,384 (GRCm39) missense possibly damaging 0.94
R1293:Siglec1 UTSW 2 130,915,451 (GRCm39) missense probably benign 0.00
R1470:Siglec1 UTSW 2 130,912,307 (GRCm39) missense probably benign 0.19
R1470:Siglec1 UTSW 2 130,912,307 (GRCm39) missense probably benign 0.19
R1533:Siglec1 UTSW 2 130,918,078 (GRCm39) missense probably benign
R1717:Siglec1 UTSW 2 130,925,932 (GRCm39) missense probably damaging 1.00
R1717:Siglec1 UTSW 2 130,915,876 (GRCm39) missense possibly damaging 0.92
R1744:Siglec1 UTSW 2 130,923,219 (GRCm39) missense probably damaging 1.00
R1852:Siglec1 UTSW 2 130,923,420 (GRCm39) missense probably damaging 0.98
R1941:Siglec1 UTSW 2 130,920,051 (GRCm39) missense possibly damaging 0.94
R2011:Siglec1 UTSW 2 130,925,277 (GRCm39) missense probably damaging 1.00
R2012:Siglec1 UTSW 2 130,925,277 (GRCm39) missense probably damaging 1.00
R2128:Siglec1 UTSW 2 130,922,417 (GRCm39) missense probably damaging 1.00
R2278:Siglec1 UTSW 2 130,913,257 (GRCm39) missense probably benign 0.28
R2403:Siglec1 UTSW 2 130,916,395 (GRCm39) missense possibly damaging 0.65
R2449:Siglec1 UTSW 2 130,920,645 (GRCm39) missense probably benign 0.44
R2885:Siglec1 UTSW 2 130,914,667 (GRCm39) missense possibly damaging 0.88
R4213:Siglec1 UTSW 2 130,916,038 (GRCm39) missense probably damaging 1.00
R4274:Siglec1 UTSW 2 130,927,734 (GRCm39) missense probably benign 0.00
R4679:Siglec1 UTSW 2 130,915,331 (GRCm39) missense possibly damaging 0.87
R4715:Siglec1 UTSW 2 130,916,356 (GRCm39) missense probably damaging 1.00
R4782:Siglec1 UTSW 2 130,917,843 (GRCm39) missense probably damaging 1.00
R4896:Siglec1 UTSW 2 130,911,789 (GRCm39) missense probably benign 0.21
R4993:Siglec1 UTSW 2 130,915,281 (GRCm39) missense possibly damaging 0.93
R5004:Siglec1 UTSW 2 130,915,331 (GRCm39) missense possibly damaging 0.87
R5004:Siglec1 UTSW 2 130,911,789 (GRCm39) missense probably benign 0.21
R5105:Siglec1 UTSW 2 130,922,320 (GRCm39) missense possibly damaging 0.69
R5137:Siglec1 UTSW 2 130,923,264 (GRCm39) missense probably damaging 1.00
R5153:Siglec1 UTSW 2 130,927,497 (GRCm39) missense probably damaging 0.99
R5311:Siglec1 UTSW 2 130,921,236 (GRCm39) missense probably damaging 1.00
R5600:Siglec1 UTSW 2 130,927,503 (GRCm39) missense probably benign 0.01
R5682:Siglec1 UTSW 2 130,925,930 (GRCm39) missense probably damaging 1.00
R5732:Siglec1 UTSW 2 130,916,188 (GRCm39) missense probably benign 0.30
R5870:Siglec1 UTSW 2 130,914,767 (GRCm39) missense probably damaging 0.99
R5898:Siglec1 UTSW 2 130,915,553 (GRCm39) missense probably damaging 1.00
R5909:Siglec1 UTSW 2 130,919,884 (GRCm39) missense probably damaging 1.00
R6488:Siglec1 UTSW 2 130,923,227 (GRCm39) missense probably damaging 0.99
R6920:Siglec1 UTSW 2 130,919,997 (GRCm39) nonsense probably null
R7064:Siglec1 UTSW 2 130,925,834 (GRCm39) missense probably benign 0.00
R7270:Siglec1 UTSW 2 130,923,471 (GRCm39) missense possibly damaging 0.67
R7355:Siglec1 UTSW 2 130,922,371 (GRCm39) missense probably benign 0.02
R7400:Siglec1 UTSW 2 130,928,015 (GRCm39) missense possibly damaging 0.73
R7470:Siglec1 UTSW 2 130,917,744 (GRCm39) missense probably benign 0.00
R7568:Siglec1 UTSW 2 130,914,602 (GRCm39) missense probably damaging 1.00
R7781:Siglec1 UTSW 2 130,923,258 (GRCm39) missense probably damaging 1.00
R7853:Siglec1 UTSW 2 130,923,212 (GRCm39) missense probably damaging 1.00
R7999:Siglec1 UTSW 2 130,913,083 (GRCm39) missense probably benign 0.28
R8191:Siglec1 UTSW 2 130,927,599 (GRCm39) missense probably damaging 1.00
R8274:Siglec1 UTSW 2 130,925,830 (GRCm39) missense probably benign
R8345:Siglec1 UTSW 2 130,920,498 (GRCm39) missense possibly damaging 0.95
R8670:Siglec1 UTSW 2 130,923,387 (GRCm39) missense probably damaging 1.00
R9102:Siglec1 UTSW 2 130,915,389 (GRCm39) missense probably benign 0.01
R9311:Siglec1 UTSW 2 130,916,013 (GRCm39) missense probably damaging 1.00
R9416:Siglec1 UTSW 2 130,925,390 (GRCm39) missense probably benign 0.01
R9462:Siglec1 UTSW 2 130,916,404 (GRCm39) missense probably damaging 1.00
R9521:Siglec1 UTSW 2 130,915,246 (GRCm39) critical splice donor site probably null
R9683:Siglec1 UTSW 2 130,921,236 (GRCm39) missense probably damaging 0.99
R9799:Siglec1 UTSW 2 130,915,941 (GRCm39) missense probably damaging 0.99
X0024:Siglec1 UTSW 2 130,922,411 (GRCm39) missense probably damaging 1.00
Z1176:Siglec1 UTSW 2 130,922,444 (GRCm39) missense possibly damaging 0.83
Z1176:Siglec1 UTSW 2 130,920,665 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCAGAGATGGGTTCATAC -3'
(R):5'- TGCTGTCCTATGACCAAGGAG -3'

Sequencing Primer
(F):5'- TGGGTTCATACTCACAGAGGACAC -3'
(R):5'- ACATAGTCCCAGTGTGGAGGTC -3'
Posted On 2021-04-30