Mutagenetix > Incidental Mutation

Incidental Mutation 'R8814:Fer1l4'

672590

Institutional Source

Beutler Lab

Gene Symbol

Fer1l4

Ensembl Gene

ENSMUSG00000013338

Gene Name

fer-1-like 4 (C. elegans)

Synonyms

9130402C12Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

156019139-156052947 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 156052243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 47 (F47L)

Ref Sequence

ENSEMBL: ENSMUSP00000105240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109611]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000109611
AA Change: F47L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: F47L

Domain	Start	End	E-Value	Type
PDB:3L9B\|A	1	122	1e-12	PDB
Blast:C2	2	96	2e-51	BLAST
low complexity region	159	172	N/A	INTRINSIC
low complexity region	178	197	N/A	INTRINSIC
C2	228	329	2.87e-7	SMART
FerI	312	383	7.93e-29	SMART
C2	391	501	3.64e-9	SMART
low complexity region	574	581	N/A	INTRINSIC
low complexity region	611	622	N/A	INTRINSIC
low complexity region	829	837	N/A	INTRINSIC
low complexity region	844	855	N/A	INTRINSIC
FerB	861	932	7.27e-37	SMART
C2	968	1076	3.73e-6	SMART
low complexity region	1249	1257	N/A	INTRINSIC
low complexity region	1280	1310	N/A	INTRINSIC
low complexity region	1327	1340	N/A	INTRINSIC
low complexity region	1397	1407	N/A	INTRINSIC
C2	1449	1548	5.65e-15	SMART
C2	1692	1822	4.22e-5	SMART
Pfam:Ferlin_C	1834	1987	1.6e-74	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	C	6: 129,325,604		probably benign	Het
Brd7	A	G	8: 88,345,154	V361A	probably benign	Het
C6	A	T	15: 4,792,784	Q595L	probably benign	Het
Cacna2d3	T	A	14: 29,097,815	Y532F	probably damaging	Het
Cep85l	A	T	10: 53,348,969	Y175N	probably benign	Het
Clca3a2	G	T	3: 144,797,764	N808K	probably benign	Het
Cpsf4	T	G	5: 145,178,868	S201R	probably benign	Het
Crispld2	A	G	8: 120,015,345	H144R	possibly damaging	Het
Cyp1b1	T	C	17: 79,713,359	E318G	probably benign	Het
Fam109a	G	T	5: 121,853,045	V157L	probably benign	Het
Flnb	A	G	14: 7,927,409	D1873G	probably damaging	Het
Gm47995	A	G	1: 151,198,988	M181V	probably benign	Het
Hace1	A	G	10: 45,652,701	Y346C	probably damaging	Het
Hemgn	G	T	4: 46,400,717	Q48K	possibly damaging	Het
Hhip	T	C	8: 80,051,472	D143G	probably damaging	Het
Ift74	C	T	4: 94,662,636	Q342*	probably null	Het
Kng2	A	T	16: 23,004,011	I197N	probably benign	Het
Lcat	G	A	8: 105,941,970	P167S	probably damaging	Het
Lmntd2	G	A	7: 141,210,084	R672W	probably damaging	Het
Mroh2b	G	T	15: 4,941,625	L1037F	possibly damaging	Het
Msh4	A	G	3: 153,872,320	S640P	probably damaging	Het
Mterf1b	T	C	5: 4,197,456	S366P	probably damaging	Het
Nrxn1	A	T	17: 90,630,101	C643S	probably damaging	Het
Olfr1164	T	A	2: 88,092,971	I322F	probably benign	Het
Olfr1496	T	A	19: 13,781,533	I305N	possibly damaging	Het
Olfr485	T	A	7: 108,159,065	K269N	probably benign	Het
Olfr605	A	G	7: 103,442,913	V70A	probably benign	Het
Olfr709-ps1	T	A	7: 106,926,818	I214F	probably damaging	Het
Pask	C	A	1: 93,320,585	R998L	probably benign	Het
Pcdh8	A	G	14: 79,768,897	L742P	probably benign	Het
Psma3	A	G	12: 70,978,806	E32G	probably benign	Het
Samd11	T	C	4: 156,247,884	E500G	probably benign	Het
Scarb1	A	T	5: 125,294,092	D305E	probably benign	Het
Serpinb6b	A	G	13: 32,978,304	H362R	possibly damaging	Het
Siglec1	G	A	2: 131,072,744	T1484M	probably damaging	Het
Slfn8	A	G	11: 83,016,679	V346A	possibly damaging	Het
Slitrk6	G	C	14: 110,749,938	A779G	probably benign	Het
Soga1	C	T	2: 157,030,531	W965*	probably null	Het
Sub1	A	C	15: 11,984,231	V124G	probably damaging	Het
Tbc1d32	A	G	10: 56,196,592	I277T	possibly damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trappc10	A	G	10: 78,202,919	Y780H	probably damaging	Het
Trim28	T	A	7: 13,028,527	N359K	probably damaging	Het
Tspan15	G	A	10: 62,188,056	T281M	probably benign	Het
Uaca	A	G	9: 60,866,398	N396D	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,458	S103P	probably damaging	Het
Vmn2r22	C	G	6: 123,637,830	R267T	probably damaging	Het
Vmn2r7	A	G	3: 64,716,563	I112T	probably benign	Het
Vmn2r70	T	A	7: 85,565,961	I122F	probably benign	Het
Vmn2r79	C	G	7: 87,002,506	T371S	probably benign	Het
Vps8	T	C	16: 21,576,650	L1230P	probably damaging	Het
Zfp26	A	T	9: 20,438,434	V278D	probably benign	Het

Other mutations in Fer1l4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Fer1l4	APN	2	156019920	nonsense	probably null
IGL01025:Fer1l4	APN	2	156052185	missense	probably benign	0.41
IGL01103:Fer1l4	APN	2	156044441	critical splice donor site	probably null
IGL01322:Fer1l4	APN	2	156020339	splice site	probably null
IGL01391:Fer1l4	APN	2	156036456	missense	probably damaging	1.00
IGL02176:Fer1l4	APN	2	156048451	missense	probably benign
IGL02267:Fer1l4	APN	2	156031252	missense	possibly damaging	0.60
IGL02291:Fer1l4	APN	2	156019538	missense	probably damaging	1.00
IGL02385:Fer1l4	APN	2	156045428	missense	probably benign	0.04
IGL02423:Fer1l4	APN	2	156052907	missense	probably benign	0.04
IGL02596:Fer1l4	APN	2	156039132	missense	probably benign
IGL02612:Fer1l4	APN	2	156047928	missense	probably damaging	1.00
IGL02716:Fer1l4	APN	2	156029715	missense	probably damaging	1.00
IGL02738:Fer1l4	APN	2	156045728	missense	probably benign
IGL03035:Fer1l4	APN	2	156022606	missense	possibly damaging	0.95
IGL03083:Fer1l4	APN	2	156039366	unclassified	probably benign
IGL03201:Fer1l4	APN	2	156044730	missense	probably benign	0.32
IGL03349:Fer1l4	APN	2	156044734	nonsense	probably null
R0033:Fer1l4	UTSW	2	156024106	splice site	probably benign
R0356:Fer1l4	UTSW	2	156024010	missense	probably damaging	1.00
R0477:Fer1l4	UTSW	2	156052886	missense	probably benign	0.43
R0504:Fer1l4	UTSW	2	156052195	missense	probably benign	0.36
R0731:Fer1l4	UTSW	2	156024070	missense	probably benign	0.17
R0800:Fer1l4	UTSW	2	156045663	missense	possibly damaging	0.90
R0884:Fer1l4	UTSW	2	156019313	missense	possibly damaging	0.93
R1017:Fer1l4	UTSW	2	156049478	critical splice acceptor site	probably null
R1266:Fer1l4	UTSW	2	156046249	missense	possibly damaging	0.89
R1544:Fer1l4	UTSW	2	156045633	missense	probably benign	0.00
R1657:Fer1l4	UTSW	2	156035598	missense	possibly damaging	0.95
R1699:Fer1l4	UTSW	2	156029685	missense	probably benign	0.14
R1816:Fer1l4	UTSW	2	156035199	missense	probably damaging	0.98
R1950:Fer1l4	UTSW	2	156048274	missense	probably damaging	1.00
R2117:Fer1l4	UTSW	2	156039118	missense	probably benign	0.00
R2219:Fer1l4	UTSW	2	156031764	missense	probably damaging	0.99
R2220:Fer1l4	UTSW	2	156031764	missense	probably damaging	0.99
R2879:Fer1l4	UTSW	2	156052200	missense	probably damaging	1.00
R3746:Fer1l4	UTSW	2	156035048	missense	probably benign	0.01
R3806:Fer1l4	UTSW	2	156045683	missense	probably damaging	1.00
R3807:Fer1l4	UTSW	2	156045683	missense	probably damaging	1.00
R4224:Fer1l4	UTSW	2	156020389	missense	probably benign	0.37
R4274:Fer1l4	UTSW	2	156020544	missense	probably damaging	1.00
R4569:Fer1l4	UTSW	2	156036639	missense	possibly damaging	0.77
R4619:Fer1l4	UTSW	2	156047087	missense	probably damaging	1.00
R4707:Fer1l4	UTSW	2	156045623	missense	possibly damaging	0.69
R4914:Fer1l4	UTSW	2	156031300	missense	probably benign	0.41
R4915:Fer1l4	UTSW	2	156031300	missense	probably benign	0.41
R4917:Fer1l4	UTSW	2	156031300	missense	probably benign	0.41
R4918:Fer1l4	UTSW	2	156031300	missense	probably benign	0.41
R4941:Fer1l4	UTSW	2	156045089	missense	probably damaging	1.00
R5011:Fer1l4	UTSW	2	156031215	missense	probably damaging	1.00
R5013:Fer1l4	UTSW	2	156031215	missense	probably damaging	1.00
R5130:Fer1l4	UTSW	2	156049466	missense	possibly damaging	0.54
R5385:Fer1l4	UTSW	2	156037366	nonsense	probably null
R5441:Fer1l4	UTSW	2	156023257	missense	probably benign	0.00
R5555:Fer1l4	UTSW	2	156048189	missense	probably damaging	1.00
R5838:Fer1l4	UTSW	2	156051993	missense	probably benign	0.01
R6125:Fer1l4	UTSW	2	156046987	missense	probably damaging	1.00
R6184:Fer1l4	UTSW	2	156048291	missense	probably damaging	1.00
R6246:Fer1l4	UTSW	2	156024982	missense	probably damaging	0.99
R6248:Fer1l4	UTSW	2	156046171	missense	probably damaging	1.00
R6274:Fer1l4	UTSW	2	156029268	missense	probably damaging	1.00
R6298:Fer1l4	UTSW	2	156024740	missense	probably damaging	1.00
R6362:Fer1l4	UTSW	2	156048250	missense	probably benign	0.08
R6490:Fer1l4	UTSW	2	156047914	missense	possibly damaging	0.94
R6494:Fer1l4	UTSW	2	156045470	missense	probably benign	0.02
R6516:Fer1l4	UTSW	2	156035199	missense	probably damaging	0.98
R6530:Fer1l4	UTSW	2	156047865	critical splice donor site	probably null
R6740:Fer1l4	UTSW	2	156031222	missense	probably damaging	1.00
R7039:Fer1l4	UTSW	2	156036730	missense	probably benign	0.05
R7121:Fer1l4	UTSW	2	156044557	missense	probably benign	0.13
R7132:Fer1l4	UTSW	2	156045626	missense	probably damaging	0.98
R7382:Fer1l4	UTSW	2	156020749	nonsense	probably null
R7631:Fer1l4	UTSW	2	156048275	missense	probably damaging	1.00
R7693:Fer1l4	UTSW	2	156020431	missense	possibly damaging	0.51
R7730:Fer1l4	UTSW	2	156048934	missense	probably benign
R8021:Fer1l4	UTSW	2	156022591	missense	probably damaging	0.98
R8161:Fer1l4	UTSW	2	156024635	missense	probably benign	0.03
R8171:Fer1l4	UTSW	2	156048231	missense	probably benign	0.29
R8241:Fer1l4	UTSW	2	156049665	missense	probably benign
R8245:Fer1l4	UTSW	2	156045014	critical splice donor site	probably null
R8280:Fer1l4	UTSW	2	156049700	missense	probably damaging	1.00
R8369:Fer1l4	UTSW	2	156019760	missense	probably benign	0.17
R8403:Fer1l4	UTSW	2	156052243	missense	possibly damaging	0.88
R8702:Fer1l4	UTSW	2	156019390	missense	probably benign	0.00
R8804:Fer1l4	UTSW	2	156051994	missense	probably benign	0.28
R8817:Fer1l4	UTSW	2	156048223	missense	probably damaging	0.99
R9325:Fer1l4	UTSW	2	156036014	missense	probably damaging	1.00
R9342:Fer1l4	UTSW	2	156035276	missense	probably benign	0.08
R9527:Fer1l4	UTSW	2	156029697	missense	probably damaging	0.96
R9661:Fer1l4	UTSW	2	156020416	missense	probably damaging	0.98
RF030:Fer1l4	UTSW	2	156045529	small deletion	probably benign
X0063:Fer1l4	UTSW	2	156035011	missense	probably damaging	1.00
Z1177:Fer1l4	UTSW	2	156048429	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CAAATGCCCAGCACTCTGTAG -3'
(R):5'- TTGGCAATCAGTCCCATATCAGC -3'

Sequencing Primer
(F):5'- AGCACTCTGTAGCTGCTGCAG -3'
(R):5'- AGTCCCATATCAGCCCTGGATTG -3'

Posted On

2021-04-30