Incidental Mutation 'R8814:Soga1'
ID 672591
Institutional Source Beutler Lab
Gene Symbol Soga1
Ensembl Gene ENSMUSG00000055485
Gene Name suppressor of glucose, autophagy associated 1
Synonyms D430036N24Rik, 9830001H06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 157015799-157079254 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 157030531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 965 (W965*)
Ref Sequence ENSEMBL: ENSMUSP00000066556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069098]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000069098
AA Change: W965*
SMART Domains Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: W965*

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Blast:BRLZ 212 246 4e-8 BLAST
SCOP:d1fxkc_ 216 350 1e-3 SMART
Pfam:DUF3166 378 472 2.3e-31 PFAM
Pfam:DUF3166 504 593 5.3e-31 PFAM
low complexity region 637 649 N/A INTRINSIC
coiled coil region 807 867 N/A INTRINSIC
low complexity region 872 884 N/A INTRINSIC
low complexity region 938 950 N/A INTRINSIC
Pfam:DUF4482 1065 1205 3.9e-28 PFAM
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1363 1377 N/A INTRINSIC
low complexity region 1389 1418 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T C 6: 129,325,604 probably benign Het
Brd7 A G 8: 88,345,154 V361A probably benign Het
C6 A T 15: 4,792,784 Q595L probably benign Het
Cacna2d3 T A 14: 29,097,815 Y532F probably damaging Het
Cep85l A T 10: 53,348,969 Y175N probably benign Het
Clca3a2 G T 3: 144,797,764 N808K probably benign Het
Cpsf4 T G 5: 145,178,868 S201R probably benign Het
Crispld2 A G 8: 120,015,345 H144R possibly damaging Het
Cyp1b1 T C 17: 79,713,359 E318G probably benign Het
Fam109a G T 5: 121,853,045 V157L probably benign Het
Fer1l4 A G 2: 156,052,243 F47L probably benign Het
Flnb A G 14: 7,927,409 D1873G probably damaging Het
Gm47995 A G 1: 151,198,988 M181V probably benign Het
Hace1 A G 10: 45,652,701 Y346C probably damaging Het
Hemgn G T 4: 46,400,717 Q48K possibly damaging Het
Hhip T C 8: 80,051,472 D143G probably damaging Het
Ift74 C T 4: 94,662,636 Q342* probably null Het
Kng2 A T 16: 23,004,011 I197N probably benign Het
Lcat G A 8: 105,941,970 P167S probably damaging Het
Lmntd2 G A 7: 141,210,084 R672W probably damaging Het
Mroh2b G T 15: 4,941,625 L1037F possibly damaging Het
Msh4 A G 3: 153,872,320 S640P probably damaging Het
Mterf1b T C 5: 4,197,456 S366P probably damaging Het
Nrxn1 A T 17: 90,630,101 C643S probably damaging Het
Olfr1164 T A 2: 88,092,971 I322F probably benign Het
Olfr1496 T A 19: 13,781,533 I305N possibly damaging Het
Olfr485 T A 7: 108,159,065 K269N probably benign Het
Olfr605 A G 7: 103,442,913 V70A probably benign Het
Olfr709-ps1 T A 7: 106,926,818 I214F probably damaging Het
Pask C A 1: 93,320,585 R998L probably benign Het
Pcdh8 A G 14: 79,768,897 L742P probably benign Het
Psma3 A G 12: 70,978,806 E32G probably benign Het
Samd11 T C 4: 156,247,884 E500G probably benign Het
Scarb1 A T 5: 125,294,092 D305E probably benign Het
Serpinb6b A G 13: 32,978,304 H362R possibly damaging Het
Siglec1 G A 2: 131,072,744 T1484M probably damaging Het
Slfn8 A G 11: 83,016,679 V346A possibly damaging Het
Slitrk6 G C 14: 110,749,938 A779G probably benign Het
Sub1 A C 15: 11,984,231 V124G probably damaging Het
Tbc1d32 A G 10: 56,196,592 I277T possibly damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trappc10 A G 10: 78,202,919 Y780H probably damaging Het
Trim28 T A 7: 13,028,527 N359K probably damaging Het
Tspan15 G A 10: 62,188,056 T281M probably benign Het
Uaca A G 9: 60,866,398 N396D possibly damaging Het
Vmn1r84 A G 7: 12,362,458 S103P probably damaging Het
Vmn2r22 C G 6: 123,637,830 R267T probably damaging Het
Vmn2r7 A G 3: 64,716,563 I112T probably benign Het
Vmn2r70 T A 7: 85,565,961 I122F probably benign Het
Vmn2r79 C G 7: 87,002,506 T371S probably benign Het
Vps8 T C 16: 21,576,650 L1230P probably damaging Het
Zfp26 A T 9: 20,438,434 V278D probably benign Het
Other mutations in Soga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Soga1 APN 2 157030864 missense probably damaging 1.00
IGL00924:Soga1 APN 2 157040705 missense probably damaging 0.99
IGL01723:Soga1 APN 2 157030614 missense probably benign 0.00
IGL01749:Soga1 APN 2 157021541 splice site probably benign
IGL02199:Soga1 APN 2 157030945 missense probably damaging 1.00
IGL02262:Soga1 APN 2 157030906 missense probably damaging 1.00
IGL02618:Soga1 APN 2 157040566 missense probably damaging 1.00
IGL02643:Soga1 APN 2 157040743 missense probably damaging 1.00
deglutition UTSW 2 157039864 missense possibly damaging 0.63
gulp UTSW 2 157023817 nonsense probably null
IGL02835:Soga1 UTSW 2 157041934 missense possibly damaging 0.91
R0528:Soga1 UTSW 2 157020692 missense probably damaging 1.00
R0535:Soga1 UTSW 2 157033289 missense possibly damaging 0.89
R0726:Soga1 UTSW 2 157060262 missense probably damaging 1.00
R1473:Soga1 UTSW 2 157020448 nonsense probably null
R1589:Soga1 UTSW 2 157027637 missense probably benign 0.05
R1615:Soga1 UTSW 2 157020743 missense probably damaging 1.00
R1681:Soga1 UTSW 2 157030530 missense possibly damaging 0.70
R1701:Soga1 UTSW 2 157030619 missense probably damaging 1.00
R1872:Soga1 UTSW 2 157040261 missense possibly damaging 0.88
R2056:Soga1 UTSW 2 157022827 missense probably benign 0.00
R2118:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2120:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2121:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2124:Soga1 UTSW 2 157033325 missense probably damaging 1.00
R2249:Soga1 UTSW 2 157040093 missense probably benign 0.08
R3147:Soga1 UTSW 2 157020364 missense possibly damaging 0.91
R3758:Soga1 UTSW 2 157020638 missense possibly damaging 0.77
R4601:Soga1 UTSW 2 157039924 missense probably benign 0.41
R4646:Soga1 UTSW 2 157020506 missense probably damaging 1.00
R4653:Soga1 UTSW 2 157040591 missense probably damaging 1.00
R4736:Soga1 UTSW 2 157020554 missense probably damaging 1.00
R4773:Soga1 UTSW 2 157030569 missense probably benign 0.08
R4796:Soga1 UTSW 2 157020252 missense probably benign
R4999:Soga1 UTSW 2 157022856 missense probably benign 0.10
R5304:Soga1 UTSW 2 157023817 nonsense probably null
R5369:Soga1 UTSW 2 157040734 missense probably damaging 1.00
R5530:Soga1 UTSW 2 157020342 missense probably damaging 1.00
R5712:Soga1 UTSW 2 157030921 missense probably damaging 1.00
R5780:Soga1 UTSW 2 157018490 missense probably damaging 0.98
R6162:Soga1 UTSW 2 157039864 missense possibly damaging 0.63
R6253:Soga1 UTSW 2 157021419 missense probably benign 0.00
R6303:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6304:Soga1 UTSW 2 157040764 missense possibly damaging 0.91
R6523:Soga1 UTSW 2 157060343 nonsense probably null
R7216:Soga1 UTSW 2 157018370 missense possibly damaging 0.76
R7335:Soga1 UTSW 2 157031005 missense possibly damaging 0.86
R7562:Soga1 UTSW 2 157053589 missense probably damaging 1.00
R7593:Soga1 UTSW 2 157040856 missense probably benign 0.40
R7788:Soga1 UTSW 2 157027584 missense probably benign 0.09
R8013:Soga1 UTSW 2 157030786 critical splice donor site probably null
R8263:Soga1 UTSW 2 157027590 missense possibly damaging 0.94
R8299:Soga1 UTSW 2 157020731 missense possibly damaging 0.93
R9222:Soga1 UTSW 2 157039999 missense probably benign 0.08
R9563:Soga1 UTSW 2 157060262 missense probably damaging 1.00
R9607:Soga1 UTSW 2 157027568 missense probably damaging 0.96
R9645:Soga1 UTSW 2 157027470 missense probably damaging 1.00
R9690:Soga1 UTSW 2 157020214 missense probably benign 0.06
R9727:Soga1 UTSW 2 157020248 missense possibly damaging 0.89
X0019:Soga1 UTSW 2 157020264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAAACGGGCGAACTGCTTC -3'
(R):5'- ACAGTACCTGGTTGGGAGTAGG -3'

Sequencing Primer
(F):5'- GGGCGAACTGCTTCCCTTAC -3'
(R):5'- AGTAGGTCACATGCTATCTGGAC -3'
Posted On 2021-04-30