Mutagenetix > Incidental Mutation

Incidental Mutation 'R8814:Soga1'

672591

Institutional Source

Beutler Lab

Gene Symbol

Soga1

Ensembl Gene

ENSMUSG00000055485

Gene Name

suppressor of glucose, autophagy associated 1

Synonyms

D430036N24Rik, 9830001H06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.429) question?

Stock #

R8814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

157015799-157079254 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 157030531 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 965 (W965*)

Ref Sequence

ENSEMBL: ENSMUSP00000066556 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069098]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069098
AA Change: W965*

SMART Domains

Protein: ENSMUSP00000066556
Gene: ENSMUSG00000055485
AA Change: W965*

Domain	Start	End	E-Value	Type
low complexity region	15	23	N/A	INTRINSIC
low complexity region	51	66	N/A	INTRINSIC
low complexity region	97	112	N/A	INTRINSIC
low complexity region	132	148	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
Blast:BRLZ	212	246	4e-8	BLAST
SCOP:d1fxkc_	216	350	1e-3	SMART
Pfam:DUF3166	378	472	2.3e-31	PFAM
Pfam:DUF3166	504	593	5.3e-31	PFAM
low complexity region	637	649	N/A	INTRINSIC
coiled coil region	807	867	N/A	INTRINSIC
low complexity region	872	884	N/A	INTRINSIC
low complexity region	938	950	N/A	INTRINSIC
Pfam:DUF4482	1065	1205	3.9e-28	PFAM
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1363	1377	N/A	INTRINSIC
low complexity region	1389	1418	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	T	C	6: 129,325,604		probably benign	Het
Brd7	A	G	8: 88,345,154	V361A	probably benign	Het
C6	A	T	15: 4,792,784	Q595L	probably benign	Het
Cacna2d3	T	A	14: 29,097,815	Y532F	probably damaging	Het
Cep85l	A	T	10: 53,348,969	Y175N	probably benign	Het
Clca3a2	G	T	3: 144,797,764	N808K	probably benign	Het
Cpsf4	T	G	5: 145,178,868	S201R	probably benign	Het
Crispld2	A	G	8: 120,015,345	H144R	possibly damaging	Het
Cyp1b1	T	C	17: 79,713,359	E318G	probably benign	Het
Fam109a	G	T	5: 121,853,045	V157L	probably benign	Het
Fer1l4	A	G	2: 156,052,243	F47L	probably benign	Het
Flnb	A	G	14: 7,927,409	D1873G	probably damaging	Het
Gm47995	A	G	1: 151,198,988	M181V	probably benign	Het
Hace1	A	G	10: 45,652,701	Y346C	probably damaging	Het
Hemgn	G	T	4: 46,400,717	Q48K	possibly damaging	Het
Hhip	T	C	8: 80,051,472	D143G	probably damaging	Het
Ift74	C	T	4: 94,662,636	Q342*	probably null	Het
Kng2	A	T	16: 23,004,011	I197N	probably benign	Het
Lcat	G	A	8: 105,941,970	P167S	probably damaging	Het
Lmntd2	G	A	7: 141,210,084	R672W	probably damaging	Het
Mroh2b	G	T	15: 4,941,625	L1037F	possibly damaging	Het
Msh4	A	G	3: 153,872,320	S640P	probably damaging	Het
Mterf1b	T	C	5: 4,197,456	S366P	probably damaging	Het
Nrxn1	A	T	17: 90,630,101	C643S	probably damaging	Het
Olfr1164	T	A	2: 88,092,971	I322F	probably benign	Het
Olfr1496	T	A	19: 13,781,533	I305N	possibly damaging	Het
Olfr485	T	A	7: 108,159,065	K269N	probably benign	Het
Olfr605	A	G	7: 103,442,913	V70A	probably benign	Het
Olfr709-ps1	T	A	7: 106,926,818	I214F	probably damaging	Het
Pask	C	A	1: 93,320,585	R998L	probably benign	Het
Pcdh8	A	G	14: 79,768,897	L742P	probably benign	Het
Psma3	A	G	12: 70,978,806	E32G	probably benign	Het
Samd11	T	C	4: 156,247,884	E500G	probably benign	Het
Scarb1	A	T	5: 125,294,092	D305E	probably benign	Het
Serpinb6b	A	G	13: 32,978,304	H362R	possibly damaging	Het
Siglec1	G	A	2: 131,072,744	T1484M	probably damaging	Het
Slfn8	A	G	11: 83,016,679	V346A	possibly damaging	Het
Slitrk6	G	C	14: 110,749,938	A779G	probably benign	Het
Sub1	A	C	15: 11,984,231	V124G	probably damaging	Het
Tbc1d32	A	G	10: 56,196,592	I277T	possibly damaging	Het
Tln2	C	A	9: 67,221,411	E1465D	possibly damaging	Het
Trappc10	A	G	10: 78,202,919	Y780H	probably damaging	Het
Trim28	T	A	7: 13,028,527	N359K	probably damaging	Het
Tspan15	G	A	10: 62,188,056	T281M	probably benign	Het
Uaca	A	G	9: 60,866,398	N396D	possibly damaging	Het
Vmn1r84	A	G	7: 12,362,458	S103P	probably damaging	Het
Vmn2r22	C	G	6: 123,637,830	R267T	probably damaging	Het
Vmn2r7	A	G	3: 64,716,563	I112T	probably benign	Het
Vmn2r70	T	A	7: 85,565,961	I122F	probably benign	Het
Vmn2r79	C	G	7: 87,002,506	T371S	probably benign	Het
Vps8	T	C	16: 21,576,650	L1230P	probably damaging	Het
Zfp26	A	T	9: 20,438,434	V278D	probably benign	Het

Other mutations in Soga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Soga1	APN	2	157030864	missense	probably damaging	1.00
IGL00924:Soga1	APN	2	157040705	missense	probably damaging	0.99
IGL01723:Soga1	APN	2	157030614	missense	probably benign	0.00
IGL01749:Soga1	APN	2	157021541	splice site	probably benign
IGL02199:Soga1	APN	2	157030945	missense	probably damaging	1.00
IGL02262:Soga1	APN	2	157030906	missense	probably damaging	1.00
IGL02618:Soga1	APN	2	157040566	missense	probably damaging	1.00
IGL02643:Soga1	APN	2	157040743	missense	probably damaging	1.00
deglutition	UTSW	2	157039864	missense	possibly damaging	0.63
gulp	UTSW	2	157023817	nonsense	probably null
IGL02835:Soga1	UTSW	2	157041934	missense	possibly damaging	0.91
R0528:Soga1	UTSW	2	157020692	missense	probably damaging	1.00
R0535:Soga1	UTSW	2	157033289	missense	possibly damaging	0.89
R0726:Soga1	UTSW	2	157060262	missense	probably damaging	1.00
R1473:Soga1	UTSW	2	157020448	nonsense	probably null
R1589:Soga1	UTSW	2	157027637	missense	probably benign	0.05
R1615:Soga1	UTSW	2	157020743	missense	probably damaging	1.00
R1681:Soga1	UTSW	2	157030530	missense	possibly damaging	0.70
R1701:Soga1	UTSW	2	157030619	missense	probably damaging	1.00
R1872:Soga1	UTSW	2	157040261	missense	possibly damaging	0.88
R2056:Soga1	UTSW	2	157022827	missense	probably benign	0.00
R2118:Soga1	UTSW	2	157033325	missense	probably damaging	1.00
R2120:Soga1	UTSW	2	157033325	missense	probably damaging	1.00
R2121:Soga1	UTSW	2	157033325	missense	probably damaging	1.00
R2124:Soga1	UTSW	2	157033325	missense	probably damaging	1.00
R2249:Soga1	UTSW	2	157040093	missense	probably benign	0.08
R3147:Soga1	UTSW	2	157020364	missense	possibly damaging	0.91
R3758:Soga1	UTSW	2	157020638	missense	possibly damaging	0.77
R4601:Soga1	UTSW	2	157039924	missense	probably benign	0.41
R4646:Soga1	UTSW	2	157020506	missense	probably damaging	1.00
R4653:Soga1	UTSW	2	157040591	missense	probably damaging	1.00
R4736:Soga1	UTSW	2	157020554	missense	probably damaging	1.00
R4773:Soga1	UTSW	2	157030569	missense	probably benign	0.08
R4796:Soga1	UTSW	2	157020252	missense	probably benign
R4999:Soga1	UTSW	2	157022856	missense	probably benign	0.10
R5304:Soga1	UTSW	2	157023817	nonsense	probably null
R5369:Soga1	UTSW	2	157040734	missense	probably damaging	1.00
R5530:Soga1	UTSW	2	157020342	missense	probably damaging	1.00
R5712:Soga1	UTSW	2	157030921	missense	probably damaging	1.00
R5780:Soga1	UTSW	2	157018490	missense	probably damaging	0.98
R6162:Soga1	UTSW	2	157039864	missense	possibly damaging	0.63
R6253:Soga1	UTSW	2	157021419	missense	probably benign	0.00
R6303:Soga1	UTSW	2	157040764	missense	possibly damaging	0.91
R6304:Soga1	UTSW	2	157040764	missense	possibly damaging	0.91
R6523:Soga1	UTSW	2	157060343	nonsense	probably null
R7216:Soga1	UTSW	2	157018370	missense	possibly damaging	0.76
R7335:Soga1	UTSW	2	157031005	missense	possibly damaging	0.86
R7562:Soga1	UTSW	2	157053589	missense	probably damaging	1.00
R7593:Soga1	UTSW	2	157040856	missense	probably benign	0.40
R7788:Soga1	UTSW	2	157027584	missense	probably benign	0.09
R8013:Soga1	UTSW	2	157030786	critical splice donor site	probably null
R8263:Soga1	UTSW	2	157027590	missense	possibly damaging	0.94
R8299:Soga1	UTSW	2	157020731	missense	possibly damaging	0.93
R9222:Soga1	UTSW	2	157039999	missense	probably benign	0.08
R9563:Soga1	UTSW	2	157060262	missense	probably damaging	1.00
R9607:Soga1	UTSW	2	157027568	missense	probably damaging	0.96
R9645:Soga1	UTSW	2	157027470	missense	probably damaging	1.00
R9690:Soga1	UTSW	2	157020214	missense	probably benign	0.06
R9727:Soga1	UTSW	2	157020248	missense	possibly damaging	0.89
X0019:Soga1	UTSW	2	157020264	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ACAAACGGGCGAACTGCTTC -3'
(R):5'- ACAGTACCTGGTTGGGAGTAGG -3'

Sequencing Primer
(F):5'- GGGCGAACTGCTTCCCTTAC -3'
(R):5'- AGTAGGTCACATGCTATCTGGAC -3'

Posted On

2021-04-30