Incidental Mutation 'R8814:Vmn2r7'
ID 672592
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name vomeronasal 2, receptor 7
Synonyms 4933425M15Rik
MMRRC Submission 068649-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R8814 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 64598081-64627023 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64623984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 112 (I112T)
Ref Sequence ENSEMBL: ENSMUSP00000131220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972] [ENSMUST00000168072]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000161972
AA Change: I203T

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: I203T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168072
AA Change: I112T

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131220
Gene: ENSMUSG00000116028
AA Change: I112T

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 5.1e-72 PFAM
Pfam:Peripla_BP_6 63 245 6.1e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 4.3e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brd7 A G 8: 89,071,782 (GRCm39) V361A probably benign Het
C6 A T 15: 4,822,266 (GRCm39) Q595L probably benign Het
Cacna2d3 T A 14: 28,819,772 (GRCm39) Y532F probably damaging Het
Cep85l A T 10: 53,225,065 (GRCm39) Y175N probably benign Het
Clca3a2 G T 3: 144,503,525 (GRCm39) N808K probably benign Het
Clec2m T C 6: 129,302,567 (GRCm39) probably benign Het
Cpsf4 T G 5: 145,115,678 (GRCm39) S201R probably benign Het
Crispld2 A G 8: 120,742,084 (GRCm39) H144R possibly damaging Het
Cyp1b1 T C 17: 80,020,788 (GRCm39) E318G probably benign Het
Fer1l4 A G 2: 155,894,163 (GRCm39) F47L probably benign Het
Flnb A G 14: 7,927,409 (GRCm38) D1873G probably damaging Het
Gm47995 A G 1: 151,074,739 (GRCm39) M181V probably benign Het
Hace1 A G 10: 45,528,797 (GRCm39) Y346C probably damaging Het
Hemgn G T 4: 46,400,717 (GRCm39) Q48K possibly damaging Het
Hhip T C 8: 80,778,101 (GRCm39) D143G probably damaging Het
Ift74 C T 4: 94,550,873 (GRCm39) Q342* probably null Het
Kng2 A T 16: 22,822,761 (GRCm39) I197N probably benign Het
Lcat G A 8: 106,668,602 (GRCm39) P167S probably damaging Het
Lmntd2 G A 7: 140,789,997 (GRCm39) R672W probably damaging Het
Mroh2b G T 15: 4,971,107 (GRCm39) L1037F possibly damaging Het
Msh4 A G 3: 153,577,957 (GRCm39) S640P probably damaging Het
Mtcl2 C T 2: 156,872,451 (GRCm39) W965* probably null Het
Mterf1b T C 5: 4,247,456 (GRCm39) S366P probably damaging Het
Nrxn1 A T 17: 90,937,529 (GRCm39) C643S probably damaging Het
Or1s2 T A 19: 13,758,897 (GRCm39) I305N possibly damaging Het
Or2d3c T A 7: 106,526,025 (GRCm39) I214F probably damaging Het
Or52s6 A G 7: 103,092,120 (GRCm39) V70A probably benign Het
Or5d37 T A 2: 87,923,315 (GRCm39) I322F probably benign Het
Or5p61 T A 7: 107,758,272 (GRCm39) K269N probably benign Het
Pask C A 1: 93,248,307 (GRCm39) R998L probably benign Het
Pcdh8 A G 14: 80,006,337 (GRCm39) L742P probably benign Het
Pheta1 G T 5: 121,991,108 (GRCm39) V157L probably benign Het
Psma3 A G 12: 71,025,580 (GRCm39) E32G probably benign Het
Samd11 T C 4: 156,332,341 (GRCm39) E500G probably benign Het
Scarb1 A T 5: 125,371,156 (GRCm39) D305E probably benign Het
Serpinb6b A G 13: 33,162,287 (GRCm39) H362R possibly damaging Het
Siglec1 G A 2: 130,914,664 (GRCm39) T1484M probably damaging Het
Slfn8 A G 11: 82,907,505 (GRCm39) V346A possibly damaging Het
Slitrk6 G C 14: 110,987,370 (GRCm39) A779G probably benign Het
Sub1 A C 15: 11,984,317 (GRCm39) V124G probably damaging Het
Tbc1d32 A G 10: 56,072,688 (GRCm39) I277T possibly damaging Het
Tln2 C A 9: 67,128,693 (GRCm39) E1465D possibly damaging Het
Trappc10 A G 10: 78,038,753 (GRCm39) Y780H probably damaging Het
Trim28 T A 7: 12,762,454 (GRCm39) N359K probably damaging Het
Tspan15 G A 10: 62,023,835 (GRCm39) T281M probably benign Het
Uaca A G 9: 60,773,680 (GRCm39) N396D possibly damaging Het
Vmn1r84 A G 7: 12,096,385 (GRCm39) S103P probably damaging Het
Vmn2r22 C G 6: 123,614,789 (GRCm39) R267T probably damaging Het
Vmn2r70 T A 7: 85,215,169 (GRCm39) I122F probably benign Het
Vmn2r79 C G 7: 86,651,714 (GRCm39) T371S probably benign Het
Vps8 T C 16: 21,395,400 (GRCm39) L1230P probably damaging Het
Zfp26 A T 9: 20,349,730 (GRCm39) V278D probably benign Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64,623,234 (GRCm39) missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64,598,856 (GRCm39) missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64,626,864 (GRCm39) missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64,598,868 (GRCm39) missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64,600,446 (GRCm39) missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64,600,443 (GRCm39) missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64,598,666 (GRCm39) missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64,614,639 (GRCm39) missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64,623,397 (GRCm39) missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64,598,460 (GRCm39) missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64,598,439 (GRCm39) missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64,623,900 (GRCm39) missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64,623,788 (GRCm39) missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64,624,000 (GRCm39) missense probably benign
R1065:Vmn2r7 UTSW 3 64,614,559 (GRCm39) missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64,599,025 (GRCm39) missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64,632,223 (GRCm39) missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64,614,500 (GRCm39) missense probably benign
R1509:Vmn2r7 UTSW 3 64,623,881 (GRCm39) nonsense probably null
R1519:Vmn2r7 UTSW 3 64,623,876 (GRCm39) missense possibly damaging 0.95
R1706:Vmn2r7 UTSW 3 64,598,880 (GRCm39) missense possibly damaging 0.79
R2113:Vmn2r7 UTSW 3 64,599,025 (GRCm39) missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64,632,412 (GRCm39) missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64,627,032 (GRCm39) missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64,626,937 (GRCm39) missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64,600,414 (GRCm39) missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64,623,138 (GRCm39) intron probably benign
R4333:Vmn2r7 UTSW 3 64,598,199 (GRCm39) missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64,598,110 (GRCm39) missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64,623,825 (GRCm39) missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64,626,864 (GRCm39) missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64,598,205 (GRCm39) missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64,598,088 (GRCm39) missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64,623,745 (GRCm39) missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64,623,658 (GRCm39) missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64,614,654 (GRCm39) missense probably benign
R5977:Vmn2r7 UTSW 3 64,623,464 (GRCm39) nonsense probably null
R6019:Vmn2r7 UTSW 3 64,623,643 (GRCm39) missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64,632,436 (GRCm39) missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64,623,339 (GRCm39) missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64,614,495 (GRCm39) missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64,598,248 (GRCm39) missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64,598,760 (GRCm39) missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64,598,542 (GRCm39) missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64,623,987 (GRCm39) missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64,623,198 (GRCm39) missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64,598,301 (GRCm39) missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64,624,014 (GRCm39) missense probably benign
R7557:Vmn2r7 UTSW 3 64,632,394 (GRCm39) missense probably benign
R7864:Vmn2r7 UTSW 3 64,598,947 (GRCm39) missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64,614,479 (GRCm39) missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64,623,507 (GRCm39) missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64,600,527 (GRCm39) missense probably benign 0.00
R9497:Vmn2r7 UTSW 3 64,614,474 (GRCm39) missense probably benign 0.04
R9722:Vmn2r7 UTSW 3 64,598,407 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGTGGAACTCTTTACTGC -3'
(R):5'- TCTACAGTAGGATGTGAGGGC -3'

Sequencing Primer
(F):5'- GTGGAACTCTTTACTGCATCAACAGC -3'
(R):5'- TGTGAGGGCAAAGGGATCCC -3'
Posted On 2021-04-30